ID: 904344818

View in Genome Browser
Species Human (GRCh38)
Location 1:29860895-29860917
Sequence ACCAGCCAGAGGTCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904344818_904344827 28 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344827 1:29860946-29860968 ACACTACCTACTGCAGGAGGTGG No data
904344818_904344822 3 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344822 1:29860921-29860943 GACCTTACTTGGGTCTTGCTTGG No data
904344818_904344825 22 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344825 1:29860940-29860962 TTGGGCACACTACCTACTGCAGG No data
904344818_904344823 4 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344823 1:29860922-29860944 ACCTTACTTGGGTCTTGCTTGGG No data
904344818_904344826 25 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344826 1:29860943-29860965 GGCACACTACCTACTGCAGGAGG No data
904344818_904344820 -8 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344820 1:29860910-29860932 TGGCTGGTGACGACCTTACTTGG No data
904344818_904344821 -7 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344821 1:29860911-29860933 GGCTGGTGACGACCTTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904344818 Original CRISPR ACCAGCCAGAGGTCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr