ID: 904344823

View in Genome Browser
Species Human (GRCh38)
Location 1:29860922-29860944
Sequence ACCTTACTTGGGTCTTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904344818_904344823 4 Left 904344818 1:29860895-29860917 CCAGCTGGGGACCTCTGGCTGGT No data
Right 904344823 1:29860922-29860944 ACCTTACTTGGGTCTTGCTTGGG No data
904344819_904344823 -7 Left 904344819 1:29860906-29860928 CCTCTGGCTGGTGACGACCTTAC No data
Right 904344823 1:29860922-29860944 ACCTTACTTGGGTCTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904344823 Original CRISPR ACCTTACTTGGGTCTTGCTT GGG Intergenic
No off target data available for this crispr