ID: 904346524

View in Genome Browser
Species Human (GRCh38)
Location 1:29875596-29875618
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 4, 1: 21, 2: 29, 3: 92, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904346524_904346532 14 Left 904346524 1:29875596-29875618 CCACAACCTGCAGCAACCTGCCC 0: 4
1: 21
2: 29
3: 92
4: 527
Right 904346532 1:29875633-29875655 AAACAACTCAGGAAGCCAGCCGG No data
904346524_904346530 3 Left 904346524 1:29875596-29875618 CCACAACCTGCAGCAACCTGCCC 0: 4
1: 21
2: 29
3: 92
4: 527
Right 904346530 1:29875622-29875644 AAGCCTGCAACAAACAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904346524 Original CRISPR GGGCAGGTTGCTGCAGGTTG TGG (reversed) Intergenic
901093863 1:6662826-6662848 GAGCAGGTTGTTGCTGGCTGGGG - Intronic
901988804 1:13095891-13095913 ATGCAAGTTGCTGCATGTTGAGG + Intergenic
901993009 1:13130876-13130898 ATGCAAGTTGCTGCATGTTGAGG - Intergenic
902794483 1:18792337-18792359 GGGCAGGGTGCTGTGGGTTGCGG - Intergenic
904310109 1:29623666-29623688 GGGAAGCTTGCTGCAGGGTATGG + Intergenic
904346524 1:29875596-29875618 GGGCAGGTTGCTGCAGGTTGTGG - Intergenic
904421606 1:30398050-30398072 GGTCAGGCTGCAGCAGGATGAGG + Intergenic
905343829 1:37298007-37298029 TGGCATGTTCCTACAGGTTGGGG + Intergenic
906612649 1:47213984-47214006 GGACAGTTTGCTGGATGTTGAGG + Intergenic
907632951 1:56102464-56102486 GGTGTGGTTGCTGAAGGTTGGGG + Intergenic
908020977 1:59898345-59898367 GGACAGCTTGCTGGAGGATGAGG + Intronic
908221312 1:62009534-62009556 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
909021990 1:70441658-70441680 GGGCAGCTTGCTGCAGGTTGTGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909073316 1:71023139-71023161 GGTCAGGCTGCAGCAGGTTTTGG - Intronic
909093779 1:71260895-71260917 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
909139850 1:71849720-71849742 GGGGTGGTTGCTGAAGGTTGGGG - Intronic
909491256 1:76229107-76229129 GGGCGGGTTGCTGCAGGTTGTGG - Intronic
909767381 1:79373232-79373254 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
910187707 1:84561683-84561705 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
910830626 1:91457574-91457596 GGACAAATTGCTGCAGATTGTGG - Intergenic
911649568 1:100372245-100372267 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
913665928 1:121048898-121048920 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914017326 1:143832174-143832196 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
914655937 1:149740706-149740728 GGGCAGGTGGCCCCAGGTTGTGG - Intergenic
915151468 1:153835499-153835521 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
915493606 1:156265863-156265885 GAGCAGGTTGCTAAAGGTGGGGG + Exonic
915544124 1:156586293-156586315 AGACAGGGTGCTGCAGGATGGGG + Intronic
915600314 1:156919299-156919321 GTGGTGGTTGCTGAAGGTTGCGG - Intergenic
916778678 1:167998385-167998407 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
917121990 1:171652576-171652598 GTGCACGTTGCTGCAGCTTTGGG - Exonic
917669586 1:177260602-177260624 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
918392220 1:184078132-184078154 GTGGTGGTTGCTGAAGGTTGCGG - Intergenic
918411708 1:184265790-184265812 TGGCTGGTTGCTAAAGGTTGGGG - Intergenic
918606038 1:186427114-186427136 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
920547908 1:206833962-206833984 GGGCTGGCTGCTGCAGGGTGTGG + Intronic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
920705051 1:208244463-208244485 GGGCAGGGTGCTGGCGGTGGCGG - Intergenic
920933049 1:210406839-210406861 GGGCAGGTTGCTTCCTGTAGGGG + Intronic
921090917 1:211841611-211841633 GTGATGGTTGCTGGAGGTTGAGG + Intergenic
921771648 1:219047656-219047678 GGGCGAGCTGCTGCAGGGTGTGG + Intergenic
922333486 1:224598630-224598652 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
922369833 1:224898220-224898242 GGCCTGATTGCTGCAGGTTGTGG + Intronic
922757840 1:228106311-228106333 GGGCAGGGAGCTGCAGGCTGTGG + Intergenic
923211885 1:231810956-231810978 GGGAAAGTTGCTGCACCTTGTGG + Intronic
923421648 1:233822118-233822140 GGGCAAGTTGAAGCAGGGTGGGG + Intergenic
923481135 1:234385151-234385173 GGGGTGGTTGCTGAAGTTTGGGG + Intergenic
924258152 1:242203003-242203025 GAGCTAGTTGCTGCAAGTTGTGG - Intronic
924544999 1:245018519-245018541 GGGCAGGGTGCTGGTGGTGGTGG + Intronic
924700622 1:246448519-246448541 GGGCTTGTAGCTGCAGGTCGTGG - Intronic
1062768012 10:80180-80202 GGGCAGGATGCTGAGGGTAGAGG + Intergenic
1063558982 10:7108867-7108889 AGGCAGGTTGGGGCAGGTTGAGG + Intergenic
1065915784 10:30354127-30354149 GGGCAGGGTGCAGGGGGTTGGGG - Intronic
1066399299 10:35059350-35059372 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1066478844 10:35775320-35775342 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1070531536 10:77341658-77341680 GGAAAAGTTGCTGAAGGTTGGGG + Intronic
1071278848 10:84081370-84081392 GGGCAGGATGCAGCAGGCTTTGG - Intergenic
1071784125 10:88880281-88880303 GGGACGGTTGCTGCAGGTTCGGG + Exonic
1071851522 10:89576052-89576074 GTGGTGGTTGCTGAAGGTTGTGG + Intergenic
1072094624 10:92165471-92165493 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1073435523 10:103513657-103513679 GGGCAAGTTGAAGCAGGTGGAGG + Intronic
1074363441 10:112840071-112840093 GGCCAGGTTGCTGCAGACTGTGG - Intergenic
1074437577 10:113446988-113447010 TAGGAGGTTGCTGCAGGTTGTGG + Intergenic
1075168412 10:120090576-120090598 GTGATGGTTGCTGAAGGTTGTGG - Intergenic
1075596174 10:123730895-123730917 GGACTGGTTGCTGCAGGTTGTGG + Intronic
1075596622 10:123735648-123735670 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1077356912 11:2122886-2122908 GGACAGGTTCCTCCAGGATGAGG + Intergenic
1077483989 11:2830552-2830574 GGGCTGGGAGCTGCAGGATGGGG + Intronic
1077572749 11:3353883-3353905 GGGGAGGTTCCTGAAGGTAGGGG + Intronic
1077740464 11:4840059-4840081 TGGCAGGTGGCTACAGGATGAGG + Intronic
1079383056 11:19955937-19955959 TGGCAGGTTCCAGCAGGGTGTGG + Intronic
1079687442 11:23377494-23377516 GGGCAGTGTCCTGCAGGCTGAGG + Intergenic
1080971952 11:37288266-37288288 GAGGTGGTTGCTGAAGGTTGAGG + Intergenic
1081902323 11:46639452-46639474 GGGCTGGTTGCTTCAGGTTGTGG + Intronic
1083071323 11:59985807-59985829 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1083678359 11:64340333-64340355 GGGCAGGTGGCAGCGGGTTGGGG + Intronic
1084138173 11:67203067-67203089 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1084321411 11:68375464-68375486 GGGAAGGGTGCTCCAGGTGGTGG - Intronic
1084322683 11:68382350-68382372 TGGCAGGTTGTGGCAGGTTCTGG - Intronic
1084331321 11:68432301-68432323 GGACCGGTGGCTGGAGGTTGAGG - Intronic
1084472845 11:69373270-69373292 GGGCAGGTTCCAGAAGGTTCTGG + Intergenic
1084642325 11:70433288-70433310 GGGCAGGGCGCTGCAGCGTGGGG - Intronic
1084739129 11:71127506-71127528 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1086081836 11:82911161-82911183 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1086338199 11:85820976-85820998 AGGCAGGGTGCTGCATGCTGGGG + Intergenic
1087095608 11:94314651-94314673 GGGCTGGCTGTTACAGGTTGTGG - Intergenic
1087295396 11:96367132-96367154 GGGCTAGTTGCTGAAGGCTGGGG + Intronic
1087665550 11:101042988-101043010 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1087833963 11:102851195-102851217 GGGCAGTTTGCCGCAGGTTGTGG + Intergenic
1088123256 11:106394403-106394425 GGGCAGGGTGTTGCAGGATGTGG - Intergenic
1088409743 11:109521009-109521031 GGGCAGATTGCTGCAGGCTGTGG + Intergenic
1088660359 11:112039280-112039302 GGGCAGGGTGCTGAAGGTGTAGG - Exonic
1089198675 11:116710520-116710542 AGGGAGGATGCTGCAGGTGGAGG - Intergenic
1089216239 11:116836357-116836379 GCGCAGCTTGCTGAAGGTGGAGG + Exonic
1089762575 11:120739134-120739156 GGGCAGGTGGCTACAGGAGGGGG - Intronic
1090737931 11:129627881-129627903 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1091093779 11:132797864-132797886 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1091390962 12:125816-125838 GGGCAGGCTGCTGCCGGCCGGGG - Exonic
1092132044 12:6119475-6119497 GGGGAGGGTGCTGCATGTGGTGG - Intronic
1093512827 12:19949227-19949249 GGGCTGGTTGCTGCAGACTGTGG - Intergenic
1093641065 12:21527601-21527623 GGGCAGGTTGCTCCAGGATAGGG - Intronic
1093658498 12:21725463-21725485 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1093686861 12:22066398-22066420 GTGGTGGTTGCTGAAGGTTGAGG + Intronic
1094001949 12:25705249-25705271 GAGCAGGTTGCTGCAGGTTATGG - Intergenic
1094084552 12:26575232-26575254 AGGGATGTTGCTGAAGGTTGGGG + Intronic
1094754123 12:33446611-33446633 AGGGTGGTTGCTGAAGGTTGGGG + Intergenic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1095168878 12:39009439-39009461 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1095535269 12:43238504-43238526 GGGCTGTGTGCTGCAGGTTGTGG + Intergenic
1095724392 12:45435944-45435966 GGGCAGGTTGCTGCAGGCTGAGG - Intronic
1095912027 12:47437413-47437435 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1095948280 12:47766341-47766363 GGGCAGGTTGCAGCACTGTGAGG - Intronic
1096160263 12:49370779-49370801 GGGCAGGTGGGAGGAGGTTGGGG - Intronic
1096217722 12:49807773-49807795 GGGCAGGTTGCTGCAGGCAGTGG - Intronic
1096500515 12:52061759-52061781 GGGCAGGGTGGGGCAGGGTGGGG - Intergenic
1096683089 12:53269833-53269855 GGTTAAGCTGCTGCAGGTTGGGG + Exonic
1097108693 12:56641616-56641638 GCGGAGGTTGCAGGAGGTTGTGG - Intronic
1097123453 12:56753844-56753866 CAGCAGGTTGCTGTAGATTGTGG + Intronic
1097150847 12:56978880-56978902 GTGGTGGTGGCTGCAGGTTGAGG - Intergenic
1097550368 12:61060661-61060683 GGGATGATTGCTGAAGGTTGGGG - Intergenic
1097573795 12:61365211-61365233 GAGCTGGTTGCTGCAGACTGTGG + Intergenic
1098427137 12:70377545-70377567 GTGGTGGTTGCTGAAGGTTGAGG + Intronic
1098805900 12:75020030-75020052 GGGAAGGCTGCAGCAGCTTGTGG + Intergenic
1099134948 12:78885646-78885668 GGGCCAGGTGCTGCAGGCTGAGG + Intronic
1099455471 12:82857459-82857481 GCGCAGGATGCAGCATGTTGTGG + Exonic
1100468354 12:94869213-94869235 GGGGTGGTTGCTGAAGGTTGGGG - Intergenic
1100814354 12:98371656-98371678 AGGCTGGTTGCTGCAGATTGTGG + Intergenic
1101974278 12:109341906-109341928 GGGTAGGCTGCTGCAGGCTGTGG + Intergenic
1101978577 12:109384833-109384855 AGTCAGGTTGCTGCAGGTGGAGG - Intronic
1101997370 12:109534673-109534695 GAGCAGGTTGAAGCAGGTGGAGG - Exonic
1102194634 12:111016291-111016313 GAGCAGGTTGCAGCATCTTGGGG - Intergenic
1103447322 12:121002549-121002571 GGGCAGGTAGCGGGAGGCTGGGG + Intronic
1103751640 12:123168039-123168061 GGTCACGTTGCTGAAGCTTGAGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1103945393 12:124523328-124523350 GGGCAGGTGGCTGCCTGTTCTGG + Intronic
1104968955 12:132522518-132522540 GAGCAGGTTGCTGAGGGTTCAGG + Intronic
1105998452 13:25695361-25695383 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1106418600 13:29567209-29567231 GGGCAGGTTGCAGCATTTTTTGG + Intronic
1106871720 13:34029140-34029162 GAGCAGCTTGCTGCAGCTTGTGG - Intergenic
1107021694 13:35758930-35758952 GGGCATGTTGCTGCAGGTTGTGG - Intergenic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107778640 13:43875534-43875556 GGGTTGCTTGCTGCAGGTTGTGG - Intronic
1107892596 13:44927346-44927368 GGGCAGGTTGCTGCAGGTTGCGG + Intergenic
1108349846 13:49581899-49581921 GGCCAGGTTGCAGCAGGTTGAGG + Intronic
1108440520 13:50448514-50448536 AGGCAGGTTGCTGCAGGCTGTGG - Intronic
1110226741 13:73127773-73127795 GTGCTGGTTGCTTAAGGTTGGGG - Intergenic
1110470726 13:75856675-75856697 GGGGAGCTCGCTGCAGGTTCAGG - Intronic
1110640228 13:77815291-77815313 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1110746421 13:79058932-79058954 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1112161557 13:96873693-96873715 GAGTAGGGTGCTGCAGATTGTGG - Intergenic
1112279739 13:98052036-98052058 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1112573165 13:100612075-100612097 GGGCAGGCTGGTGCAGGAGGAGG - Intronic
1112942844 13:104886689-104886711 GACAAGGTTTCTGCAGGTTGTGG + Intergenic
1113109144 13:106803158-106803180 GCGCAGGTTCCTGCAAGTCGAGG - Intergenic
1113629849 13:111874705-111874727 GGGAAGGTTGCTGCAGGTCGTGG + Intergenic
1114201508 14:20525354-20525376 CTGCAGGTTGCTGCAGATTTCGG - Intergenic
1114442711 14:22763588-22763610 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1115468475 14:33742611-33742633 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1115888469 14:38000849-38000871 GGGCAGGATGGATCAGGTTGTGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116862919 14:50008671-50008693 GGGGAGGTTGCTGCAGTGGGAGG + Intergenic
1121266051 14:92603348-92603370 GGGCAGGGGGCTGAAGGGTGGGG - Intronic
1121526678 14:94624181-94624203 GGGCAGGCTGCTGCAGCTGAAGG - Intronic
1121712705 14:96051414-96051436 GAGCAGGTTGCTCCAGCCTGAGG + Intronic
1122246035 14:100404237-100404259 GGGCACGGTGCTGCAAGGTGCGG + Intronic
1122267659 14:100554199-100554221 GAGCAGGTTCCTGGAGGCTGCGG + Intronic
1122294806 14:100699383-100699405 TGGCAGGTTGTTGCAGGTGTGGG + Intergenic
1122480477 14:102044088-102044110 GGGAAGGATGCTGCAGGGCGTGG + Intronic
1122592834 14:102867653-102867675 GGGCTGGGGGCTGCAGGTCGAGG + Intronic
1124397296 15:29314392-29314414 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1124501953 15:30236274-30236296 GGGAAAGTGGCTTCAGGTTGTGG + Intergenic
1124606048 15:31171138-31171160 AGGCAGGTTGCGGGAGGCTGGGG - Intergenic
1124709131 15:31990767-31990789 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1124741611 15:32302378-32302400 GGGAAAGTGGCTTCAGGTTGTGG - Intergenic
1124950522 15:34315303-34315325 GGGTGGGCTGCTGAAGGTTGTGG - Intronic
1125624038 15:41091515-41091537 GGGCAGGTGGGTGCAGGAGGAGG - Intronic
1126339333 15:47622090-47622112 GGGTAGATTGCTGGTGGTTGAGG + Intronic
1126477414 15:49079927-49079949 GCGCAGGTTGCTGCACCGTGTGG + Intergenic
1128912646 15:71530277-71530299 GGGCTGGTTCCAGCAAGTTGAGG + Intronic
1129004282 15:72359122-72359144 GGACAGGTTGCTTCTGGTTCTGG + Intronic
1129246290 15:74280846-74280868 GGGCAGGGTGAGGCAGGGTGGGG - Intronic
1129701835 15:77772780-77772802 GGGCAGGCAGCTGGAGGTGGGGG - Intronic
1129701945 15:77773251-77773273 TGGCATGTTGCAGCAGGCTGTGG + Intronic
1130408034 15:83619760-83619782 GGTGGGGTTGCTGAAGGTTGGGG + Intergenic
1130688965 15:86063881-86063903 GGGTAGGTTGCTGGAGGGTGGGG + Intergenic
1130814641 15:87418405-87418427 GGACAGGTTGCTGCAGGTTGTGG + Intergenic
1132015063 15:98308089-98308111 AGGCAGGTGGCTACAGGTTGTGG + Intergenic
1132255366 15:100372400-100372422 TTGCAGGGTGCTGAAGGTTGGGG - Intergenic
1133232061 16:4371677-4371699 GGTCAGGTGGCCGCAGGGTGAGG + Intronic
1133271429 16:4612640-4612662 GGGCAGGAGGCTGCAGGGGGAGG - Intronic
1133536984 16:6711813-6711835 GGGAAGGTTTCTCCAGGTAGAGG - Intronic
1134071654 16:11263891-11263913 GGGTGGGTGGCAGCAGGTTGGGG - Intronic
1134472622 16:14540699-14540721 AGGCAGATTGCTGGAGGCTGAGG + Intronic
1135114931 16:19716377-19716399 GGTCAGGGTGGTGGAGGTTGTGG + Intronic
1135878773 16:26231532-26231554 GTGCTGGTTGTTGCAGGTGGAGG - Intergenic
1135908151 16:26532907-26532929 GGTTAGGTTGCTGCTGCTTGAGG + Intergenic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136077363 16:27826361-27826383 GGACAGGAGGCTGCAGGGTGGGG - Intronic
1136607468 16:31346140-31346162 GGGCTGGTTGCTGCAGGCTGGGG - Intergenic
1136614964 16:31393128-31393150 AGCCAGGTCCCTGCAGGTTGTGG + Intergenic
1137361108 16:47816151-47816173 GGGCAGGTTCCTGGGGCTTGGGG + Intergenic
1138212321 16:55173899-55173921 GGTCAGGCTGCTGAAGGTTCTGG + Intergenic
1139002800 16:62534186-62534208 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1140595723 16:76407947-76407969 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1141228102 16:82138548-82138570 GGGCAGGTTGCTGCAGGTGACGG - Intergenic
1141619137 16:85227596-85227618 GGGGAGGTTCTTGCAGGTTGGGG + Intergenic
1141938993 16:87261770-87261792 GGGAAGGATGTTGTAGGTTGGGG - Intronic
1142359227 16:89618982-89619004 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359243 16:89619013-89619035 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359255 16:89619043-89619065 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359270 16:89619074-89619096 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359282 16:89619104-89619126 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359295 16:89619135-89619157 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359310 16:89619165-89619187 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359351 16:89619256-89619278 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359364 16:89619286-89619308 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359379 16:89619316-89619338 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1142359392 16:89619346-89619368 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359407 16:89619377-89619399 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359422 16:89619408-89619430 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359436 16:89619438-89619460 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359450 16:89619468-89619490 GGGCAGGGGGCTGCAGGGAGGGG - Intronic
1142359464 16:89619498-89619520 GGGCAGGGAGCTGCAGGGAGGGG - Intronic
1144221369 17:13102773-13102795 GGGTAGGTTGCTGCAGGTTGTGG + Intergenic
1144224066 17:13127691-13127713 AGGCAGGTTGATGTAGGGTGTGG + Intergenic
1144411056 17:15002218-15002240 GGGCAGGTTGACGCAGGTATGGG - Intergenic
1145014484 17:19387504-19387526 GGGCAGGCTGCGGCGGGCTGGGG - Intergenic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1145878237 17:28335780-28335802 GGGCAGGCGGCTGCAGGCTAGGG + Exonic
1145912592 17:28551257-28551279 GGGCAGGTTGCTGGTGAATGTGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146833974 17:36094972-36094994 GGTCAGGTTGCAGCAGGTGTGGG + Intergenic
1146848567 17:36201779-36201801 GGTCAGGTTGCAGCAGGTGTGGG + Intronic
1147400288 17:40176936-40176958 AGGCAGGGAGCAGCAGGTTGTGG - Intergenic
1147507517 17:41034411-41034433 GTGCAGCTGGCAGCAGGTTGGGG + Exonic
1148050020 17:44765291-44765313 GGCCAGGTGGCTGCAGAGTGGGG - Intronic
1148157610 17:45432638-45432660 GGGAAGGGTGCGGCAGGTGGCGG - Intronic
1148583162 17:48757564-48757586 GGGGAGGTGGCTGGAGGTTCTGG - Intergenic
1148666520 17:49379022-49379044 GGGAAGGGTGTTCCAGGTTGTGG + Intronic
1149182056 17:53951093-53951115 ATGCAGGTTGGTGCAAGTTGTGG - Intergenic
1149809242 17:59651783-59651805 GTGGTGGTTGCTGAAGGTTGAGG + Intronic
1150133373 17:62680975-62680997 GAGCAGGGGGCTGCAGGCTGGGG + Intronic
1150227666 17:63532577-63532599 GAGCAGGTCACTGCAGGGTGGGG + Intronic
1150389292 17:64781329-64781351 GGGAAGGGTGCGGCAGGTGGCGG - Intergenic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1151797359 17:76355205-76355227 GGCCAGGCTGCTGCAGGCTCAGG - Intronic
1152045210 17:77930752-77930774 GGGCAGGTTGGAGCTGGGTGGGG - Intergenic
1152381276 17:79943505-79943527 GGGAAGGTTGCTGCCAGGTGAGG - Intronic
1152492039 17:80641814-80641836 GGGGTGGTTGCTGAAGGTAGGGG + Intronic
1152571993 17:81125005-81125027 GGCCAGGTCGCTGCAGGCAGGGG + Exonic
1152800321 17:82327906-82327928 GGGCCGCTGGCTGCAGGTTGTGG - Intronic
1152960958 18:79926-79948 GGGCAGGATGCTGAGGGTAGAGG + Intergenic
1153871888 18:9329410-9329432 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1154128270 18:11713562-11713584 AGGCCAGTTGCTGCAGGTTGTGG + Intronic
1154952552 18:21224461-21224483 AGGGTGGTTGCTGAAGGTTGGGG + Intergenic
1155233199 18:23794075-23794097 GGGGAGGTTCCTGGAGGGTGGGG - Intronic
1155364015 18:25032713-25032735 GGGCTGGGTGCTGCAGGGAGAGG - Intergenic
1155384849 18:25266597-25266619 GGGCAAGCTGATGCAGGGTGGGG + Intronic
1155615221 18:27714401-27714423 GGGCAGATTGCTGCTGGTTGTGG - Intergenic
1156352301 18:36311778-36311800 GGGCACGTGGGTGCAGGTGGAGG - Intronic
1156946522 18:42839802-42839824 GGGGAAGTTGTTGAAGGTTGTGG - Intronic
1157016047 18:43714785-43714807 GGGCTGGTTGCTGGAGTTTGAGG + Intergenic
1157139169 18:45088488-45088510 GGGCAGGTTACTGCTGGTCATGG - Intergenic
1157885407 18:51361635-51361657 GAGCAGATTGCTGCAGGCTGTGG - Intergenic
1158499595 18:57988211-57988233 GGGCAGGTTGCTGCCGATCGTGG + Intergenic
1158757434 18:60343353-60343375 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
1159161232 18:64646025-64646047 GGGCAGGCAGCTCCAGGCTGTGG + Intergenic
1159214999 18:65381145-65381167 GGGCAGAATGCAGCAGGTTCAGG - Intergenic
1159611249 18:70527767-70527789 GGGCTGGCTGCTGCAGATTGTGG + Intergenic
1160622195 18:80179375-80179397 GGGCATGTTGCTGCAGTCTAGGG - Intronic
1162327478 19:10007569-10007591 GGACAGTTTGCTGAGGGTTGGGG - Intronic
1162394900 19:10411862-10411884 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1162723341 19:12675390-12675412 AGGCAGGTGGCTGAAGGTCGGGG + Intronic
1162844038 19:13378519-13378541 GGGGTGGTTGCTGAAGATTGGGG - Intronic
1163376010 19:16931017-16931039 GCGGCAGTTGCTGCAGGTTGGGG - Intronic
1163649014 19:18506260-18506282 AGGCAGGTCGCTGGAGGGTGCGG - Intronic
1166106576 19:40600831-40600853 GGGCAGGAGGCTGGAGGTGGGGG - Intronic
1166334893 19:42099752-42099774 GAGCAGGTGGCTGGAGGTGGTGG + Exonic
1166634518 19:44438595-44438617 TGGCAGGTAGCTTCAGGATGGGG + Intronic
1166656195 19:44613815-44613837 GAGCAGGGTCCTGCAGGGTGAGG + Intronic
1166794908 19:45420203-45420225 GGGCATGGTCCTGCAGGTTCTGG - Intronic
1166906520 19:46113976-46113998 AGGCAGGCTGCTGTAGGTTATGG - Intergenic
1168637231 19:58005869-58005891 GGGCAGGGTGGTGGAGGGTGGGG - Intronic
925451566 2:3973598-3973620 GGGCTGGCTGCTGCAGGTTGTGG + Intergenic
925897968 2:8487851-8487873 GGGCTGGTGGCTGCAGCTCGTGG - Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
927212685 2:20648350-20648372 GGGCAGTTTGTTGCATGATGAGG - Intronic
927930226 2:27039046-27039068 GGGCCTGTTGCAGCAGGTTCAGG + Exonic
928607454 2:32956156-32956178 TGGCTGGTTGCTGAAAGTTGGGG + Intronic
929011696 2:37451488-37451510 GCACTGGTTGCTGCAGGTTATGG + Intergenic
929270941 2:39971003-39971025 GGGCAGGCTGGTGGTGGTTGGGG - Intergenic
929939050 2:46316699-46316721 GTGACGGTTGCTGAAGGTTGGGG + Intronic
930199699 2:48541121-48541143 GGGCAGATAGCTTGAGGTTGGGG + Intronic
932175831 2:69600878-69600900 GGGGTGGTTGCTGAAAGTTGGGG - Intronic
932307462 2:70714283-70714305 GGGCAGGTGGCGGTAGGGTGGGG - Intronic
932354496 2:71058088-71058110 GGGCAGGGTCCTGAAGGGTGGGG + Intergenic
932534770 2:72581669-72581691 GGGCAGGGTGCGGGAGGTGGAGG - Intronic
933929428 2:87133873-87133895 GAGCAGGCTGCTCCAGGATGGGG - Intergenic
934000758 2:87709665-87709687 GAGCAGGCTGCTCCAGGATGGGG - Intergenic
934059173 2:88278500-88278522 GTGGTGATTGCTGCAGGTTGGGG - Intergenic
934542797 2:95189978-95190000 GGGCAGCTTGCTACAGGTAGAGG - Intergenic
934625153 2:95841703-95841725 GTGGTGGTTGCTGCAGATTGAGG - Intronic
934729683 2:96648734-96648756 GGGCTGGTTGCTGCAGATGGTGG + Intergenic
934808412 2:97259568-97259590 GTGGTGGTTGCTGCAGATTGAGG + Intronic
934829097 2:97497618-97497640 GTGGTGGTTGCTGCAGATTGAGG - Intronic
935199679 2:100845365-100845387 GTACAGGTTGCTGCAGGCTGGGG + Intronic
935330412 2:101973555-101973577 GGGCTGGTTGCTGCAGATCATGG - Intergenic
935444498 2:103141831-103141853 GGGCAGATTGCTGCAGATTATGG - Intergenic
935796777 2:106649691-106649713 GTGTTGGTTGCTGAAGGTTGGGG + Intergenic
936088371 2:109485054-109485076 GTGCAGGGTTCTGCAGATTGAGG + Intronic
936300438 2:111300902-111300924 GGGCTGATTGCTACAGATTGCGG - Intergenic
936363511 2:111829512-111829534 GAGCAGGCTGCTCCAGGATGGGG + Intronic
936547044 2:113401112-113401134 GTGGTGGTTGCTGCAGATTGAGG + Intergenic
937110140 2:119360044-119360066 GCGGTGGTTGCTGAAGGTTGGGG - Intronic
937115565 2:119402741-119402763 TGGGTGGTTGCTGCAGGATGGGG - Intergenic
937325967 2:120989714-120989736 TGGCATGTTGCTGCAGGATTGGG - Exonic
937580673 2:123483892-123483914 GAGCAGGTGACGGCAGGTTGGGG + Intergenic
937818639 2:126282728-126282750 GGTGGGGTTGCTGAAGGTTGGGG - Intergenic
937947749 2:127355643-127355665 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
938058930 2:128237348-128237370 GGCCTGGTTGCTGCAGATTGCGG - Intronic
938694702 2:133824749-133824771 GTGCTGGTTGCTGCAGGTTGGGG - Intergenic
939556058 2:143674878-143674900 TGGGGGGTTGCTGAAGGTTGGGG + Intronic
940339496 2:152565330-152565352 GGAAAGGTTGCTCCAGGTGGAGG + Intronic
940367484 2:152864118-152864140 GGGCTGGTTGCTGCAATTTGTGG + Intergenic
941077695 2:161024684-161024706 GTGATGGTTGCTGAAGGTTGGGG - Intergenic
941560717 2:167040822-167040844 GGGCAGGTAGGTGCTGGTGGGGG - Intronic
941908167 2:170737102-170737124 AGGTTGGTTGCTGCAGATTGTGG - Intergenic
942877095 2:180814000-180814022 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
944256081 2:197624988-197625010 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
945446503 2:209943987-209944009 GAGCAGGTTGTTGCAGGTTGTGG + Intronic
945961756 2:216142654-216142676 GGGCCCTTTTCTGCAGGTTGGGG + Intronic
946110128 2:217407804-217407826 GGACAGGTAGCAGCAGGGTGGGG - Intronic
948320707 2:237066561-237066583 GGGCAGGTGGCAGGAGGGTGAGG - Intergenic
948580404 2:238983929-238983951 GGACAGGTTGCTGGAGATGGTGG + Intergenic
948720988 2:239899789-239899811 GTGCTGGATGCTGCAGGTCGTGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169397868 20:5250842-5250864 AGCCAGGATGCTGCAGGTGGTGG + Intergenic
1169432972 20:5556008-5556030 GTGGTGGTTGCTGAAGGTTGAGG - Intronic
1171196269 20:23201880-23201902 GGGAAGGTTGCTACAGGCAGGGG + Intergenic
1171205634 20:23278521-23278543 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1171267326 20:23782464-23782486 GGGCAGGTGGCTGCAGGCACAGG - Intergenic
1171280182 20:23889786-23889808 GGGCAGGTGGCTGCAGGCACAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1174479689 20:50822125-50822147 GGGCTGGTTGGGGCTGGTTGGGG + Intronic
1175062001 20:56252024-56252046 GGGGACGTGGCTGCTGGTTGGGG + Intergenic
1175968425 20:62671641-62671663 GGTGAGGGTGCTGCAGGCTGGGG + Intronic
1176946178 21:14984767-14984789 GGGGAGGTTGCTGAAGGTTGGGG - Intronic
1178535355 21:33405639-33405661 GGACAGGTAGCTGGATGTTGTGG - Intronic
1178704020 21:34858146-34858168 GGGAAAGTTGATGCAGCTTGGGG + Intronic
1179033758 21:37742331-37742353 GGGCAGGTGGCTGCAGGCTGTGG + Intronic
1179876937 21:44273349-44273371 GGGCGAGTTTCTGCAGGTTATGG + Intergenic
1180043514 21:45292414-45292436 GGGCAGCCTCCTTCAGGTTGGGG + Intergenic
1180842166 22:18964570-18964592 GGGCAGGTTTCTGGAGGCTCCGG - Intergenic
1181059331 22:20274311-20274333 GGGCAGGTTTCTGGAGGCTCCGG + Intronic
1181084136 22:20431589-20431611 GGGCAGGTTCCGGCTGGCTGGGG - Intronic
1181520171 22:23443271-23443293 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1181768892 22:25111646-25111668 GGGCAGGGGGCAGCAGGGTGCGG + Intronic
1181821569 22:25479864-25479886 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1182595936 22:31420447-31420469 GGGCAGGCTGCTGCAGGAATTGG + Intronic
1183234156 22:36604572-36604594 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1183341520 22:37284361-37284383 GGTCAGGGTCCTGCAGGATGTGG - Intronic
1183364517 22:37400001-37400023 AGCCAGGCTGCTGCAGGGTGAGG + Intronic
1183486372 22:38089429-38089451 GGGCAGGAGGCTCCAGGCTGGGG + Intronic
1183930226 22:41231810-41231832 GGGCAGGTTCCTGAAGGGTCTGG - Intronic
1184217481 22:43077306-43077328 GGGCAGCATGCTGCAGGCGGAGG - Intronic
1184444706 22:44540373-44540395 GGGGAGGGTGCGGCAGGGTGGGG - Intergenic
1184453638 22:44597202-44597224 GGGCAGGAGGCTGCAGGGTCGGG + Intergenic
1184678347 22:46055347-46055369 GGACAGGTTGCTCCAGCCTGCGG + Intronic
1184763316 22:46557912-46557934 GGGCAGGCTGGTGCAGGTGCTGG + Intergenic
1185084546 22:48732821-48732843 GCGGTGGTTGCTGAAGGTTGAGG - Intronic
1185149765 22:49157592-49157614 GGCCAGGCTTCTGCAGGCTGTGG + Intergenic
1185261953 22:49871707-49871729 GTGCAGATTGCTGAAGGGTGGGG + Intronic
949236410 3:1814445-1814467 GGGCTGCTTGCTGCAGGTTGTGG - Intergenic
949391858 3:3571431-3571453 GTGGAGGTTGCTGGAGGTTGGGG - Intergenic
949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG + Intergenic
949728815 3:7083202-7083224 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
950494397 3:13325042-13325064 AGGCAGTTTGGTGCAGGTTGAGG - Intronic
950632950 3:14295630-14295652 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
950785577 3:15431499-15431521 GGGGAGTATGCTGCAGGGTGAGG + Intronic
950838721 3:15946125-15946147 GTGGCGGTTGCTGAAGGTTGGGG - Intergenic
950988991 3:17411093-17411115 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
951453877 3:22869004-22869026 GGCCTGGTTGCTGCAGGGTGGGG + Intergenic
951608720 3:24466860-24466882 GTGATGGTTGCTGAAGGTTGGGG + Intronic
952805842 3:37350945-37350967 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
953411217 3:42691472-42691494 GTGCAGATGGCTGCAGGTTCAGG - Intronic
954685923 3:52370153-52370175 GGTCAGGTTGCAGTTGGTTGAGG - Exonic
956170185 3:66427146-66427168 GGGCAGAGTGCTGCAGGGTGTGG - Intronic
956697895 3:71934204-71934226 GGGCTGGTTGCTTCAGGTTGTGG - Intergenic
957574089 3:81986635-81986657 GGGAAGGCTGCAGCAGCTTGTGG - Intergenic
957653086 3:83034999-83035021 GGGCAGGCTGCTCCAGGTACCGG + Intergenic
958638935 3:96779889-96779911 CAGAAGTTTGCTGCAGGTTGGGG + Intergenic
958933396 3:100231587-100231609 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
959539744 3:107524819-107524841 GGGAAGGTGGGTGGAGGTTGTGG + Intronic
959600835 3:108183341-108183363 GGTCTGGCTGCTGCAGATTGTGG - Intronic
960145098 3:114192373-114192395 GGGTAGCTTGCTGTAGATTGTGG + Intronic
960458072 3:117898500-117898522 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
960475996 3:118129600-118129622 GGGCAGATGGCTATAGGTTGTGG - Intergenic
961471927 3:127120558-127120580 TGGCTGGTTGCTGCAGATTGTGG + Intergenic
961480233 3:127174830-127174852 GGGCAGGCTGCAGCAGTTAGAGG - Intergenic
961547799 3:127647620-127647642 GGGCAGGCTCCAGCACGTTGAGG - Intronic
961869390 3:129976817-129976839 GGCCAGGGTGCTGCCGTTTGTGG - Exonic
962116100 3:132509676-132509698 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
962488457 3:135867231-135867253 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
962532702 3:136298161-136298183 GGGCAAGTTGCAGCAGAGTGTGG + Intronic
962626326 3:137229175-137229197 GGGCAGGGTGGTGATGGTTGTGG + Intergenic
962734007 3:138307954-138307976 GGCCAGATTGCTGCAGGTCGGGG + Intronic
963608592 3:147436841-147436863 GTGATGGTTGCTGAAGGTTGGGG + Intronic
964314057 3:155424687-155424709 GGGCTGTTGGCTGCAGGTTGTGG - Intronic
964574839 3:158154324-158154346 GTGGCGGTTGCTGAAGGTTGGGG + Intronic
964617174 3:158679036-158679058 GTGATGGCTGCTGCAGGTTGAGG - Intronic
964732059 3:159878018-159878040 TGGCAGGGTGCTGGAGGTGGTGG - Intronic
965217953 3:165888621-165888643 GTGCTGCTTGCTGAAGGTTGGGG - Intergenic
965458522 3:168932507-168932529 GGGGAGGGTCCTGCAGGTGGAGG + Intergenic
965595752 3:170409098-170409120 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
965619990 3:170633701-170633723 GGGCAGAGAGCAGCAGGTTGAGG - Intronic
965965111 3:174479546-174479568 GGGCAGGCGGGTGCAGGTTGGGG + Intronic
966507801 3:180726631-180726653 GTGCAGGTTGATTCAGGTTTTGG + Intronic
967077346 3:186015535-186015557 GTGGTGGTTGCTGCAGGTTGAGG + Intergenic
967225840 3:187290318-187290340 AAGAAGGTTGCTCCAGGTTGAGG + Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
967544913 3:190714133-190714155 GTGCTGGTTGCTGAAGGTTGGGG + Intergenic
967648695 3:191958792-191958814 GGGTTGGTTGCTGCAGTTTGTGG - Intergenic
968236841 3:197036896-197036918 GGCCAGGTTTCTGCAGGTGAAGG + Intergenic
968520129 4:1031378-1031400 GGGCTGGTGGCCGCAGGGTGGGG + Intergenic
968529558 4:1083785-1083807 GGGTGGGGAGCTGCAGGTTGTGG + Intronic
969062943 4:4453336-4453358 GTGGGGGTTGCTGAAGGTTGGGG - Intronic
969167214 4:5326759-5326781 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
969262921 4:6044999-6045021 GGGCAGCATGCTGCAGGGTGGGG + Intronic
969280132 4:6165151-6165173 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
969557728 4:7924701-7924723 GGGCGGGCAGCTGCAGGTTGTGG - Intronic
970208228 4:13678408-13678430 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
970246768 4:14072317-14072339 GGGCTGGTTGCTGCAGTTGGTGG - Intergenic
970726316 4:19049406-19049428 GGGAAGCTTGCTTCAGGCTGCGG + Intergenic
971071333 4:23095897-23095919 GAGATGGTTGCTGAAGGTTGGGG - Intergenic
971735455 4:30443660-30443682 GGGCAGGATCCTGCATGGTGGGG + Intergenic
971758280 4:30730844-30730866 GGGCAGGCTCCAGCAGGTTTCGG - Exonic
971977757 4:33712188-33712210 GTGCTGGCTGCTGAAGGTTGGGG + Intergenic
972284051 4:37631336-37631358 GGGCAGAGTGGTGCAGGGTGAGG - Intronic
972401944 4:38713021-38713043 GGGCTAGTTGCTGCAGATTGTGG + Intergenic
972429790 4:38969817-38969839 GGGCAGGTTGCTGGAGCTCAGGG - Intronic
972675243 4:41254207-41254229 TGTCAGGTGGCTACAGGTTGAGG + Intergenic
972776481 4:42246062-42246084 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
973901330 4:55475604-55475626 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
974036047 4:56819435-56819457 GGACAGGATGCTGCAGGTTGTGG - Intronic
975324647 4:73045465-73045487 GTGGCGGTTGCTGAAGGTTGGGG + Intergenic
975543365 4:75536756-75536778 GGGCAGATTGCGGGAGGCTGAGG - Intronic
975860591 4:78672646-78672668 TGGCACGCTGCTGCAGGTGGAGG - Intergenic
976415538 4:84769884-84769906 GTGGTGGTTGCTGAAGGTTGAGG - Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
977091869 4:92687948-92687970 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
977104177 4:92859157-92859179 GTTCTGGTTGCTGAAGGTTGGGG - Intronic
977401364 4:96536561-96536583 GTACTGGTTGCTGAAGGTTGGGG - Intergenic
977583106 4:98746460-98746482 TGGCAGGTGGCAGGAGGTTGAGG - Intergenic
977672801 4:99715547-99715569 GGGCAGGTTTCTACAAGTTGTGG + Intergenic
977726452 4:100302234-100302256 GGGCAGGTTGTGGTTGGTTGGGG + Intergenic
979313866 4:119236379-119236401 GTGATGGTTGCTGAAGGTTGAGG + Intronic
979731158 4:124024134-124024156 GGGCAGATCACTGAAGGTTGGGG + Intergenic
980187754 4:129483192-129483214 GTGGTGGTTGCTGCAGGCTGGGG + Intergenic
981246365 4:142544429-142544451 GAGCTGGTTGCTGCAGCTGGAGG + Intronic
981329772 4:143495056-143495078 GGGGAGGTTGGGGAAGGTTGGGG + Intergenic
982606489 4:157523222-157523244 GGGCAGGGTGTTGCTGGCTGGGG - Intergenic
983203631 4:164888552-164888574 GGGCTGGTTGCTGCAGTTTGTGG + Intronic
983290131 4:165791772-165791794 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
983301012 4:165925802-165925824 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
984705448 4:182844339-182844361 TTGCAGGTTGCTGCAGGCTGTGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985440637 4:189980750-189980772 GGGGAGGTTGGGGGAGGTTGGGG + Intergenic
985440654 4:189980790-189980812 GGGGAGGTTGGGGGAGGTTGGGG + Intergenic
985440659 4:189980800-189980822 GGGGAGGTTGGGGGAGGTTGGGG + Intergenic
985440717 4:189980943-189980965 GGGGAGGTTGGGGGAGGTTGGGG + Intergenic
985440722 4:189980953-189980975 GGGGAGGTTGGGGGAGGTTGGGG + Intergenic
985548348 5:520978-521000 GTGCGGGTGGCTGCAGGCTGGGG + Intronic
985959168 5:3286732-3286754 GGGCAGGTGGGTGCAGGCAGGGG + Intergenic
986018920 5:3782714-3782736 TGGAAGGTTGCAGCAGGTGGAGG + Intergenic
986646394 5:9920700-9920722 GGACTGGTTGCTGCAGGCTGCGG + Intergenic
986661293 5:10062582-10062604 GGGCTGGTTGCTGCAGTTGTGGG - Intergenic
986694560 5:10340136-10340158 GGACTGGCTGCTGCAGATTGTGG + Intergenic
986904380 5:12476167-12476189 GGGCAGCTTGCTGAAGGTTGTGG + Intergenic
987454572 5:18127474-18127496 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
987528678 5:19086110-19086132 TGGCTGGTTGCTTCAGGCTGGGG + Intergenic
988429247 5:31100311-31100333 GGGAAGGCTGCTGGGGGTTGGGG + Intergenic
988684080 5:33511373-33511395 GGGAAAGTTGCTGTAGGTCGTGG - Intergenic
990222513 5:53608314-53608336 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
990522908 5:56596808-56596830 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
990640560 5:57779196-57779218 GGGCAGGATGCTGAGGGGTGGGG + Intergenic
990715336 5:58629973-58629995 GGGAAGGTTGCTGCAGGTTGTGG + Intronic
991919194 5:71637578-71637600 GTAGAGGTTGCTGAAGGTTGGGG + Intronic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
992271383 5:75067404-75067426 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
992730453 5:79661738-79661760 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
992758743 5:79933267-79933289 GGGGAGGTTGCTGCAGGTTGGGG - Intergenic
993787522 5:92161775-92161797 GTGGAGATTGCTGAAGGTTGGGG - Intergenic
993956252 5:94236717-94236739 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
995049588 5:107687615-107687637 GGGCAGTTTGCCTCTGGTTGGGG - Intergenic
996670888 5:126115520-126115542 GGGCTGGTTGCTGCAGGTTGTGG + Intergenic
996810142 5:127507387-127507409 GGACTGGTTGCTACAGGTTGTGG - Intergenic
996925495 5:128821751-128821773 GCGCTGGTCACTGCAGGTTGTGG - Intronic
997810056 5:136958228-136958250 GAGCTGGTTGCTGCAGATTGTGG + Intergenic
998605114 5:143625525-143625547 TGCCAGCTTGCTTCAGGTTGAGG + Intergenic
999531165 5:152464924-152464946 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
999835017 5:155360333-155360355 GTGCTGGTTGCTGAAGGTTAGGG + Intergenic
999927539 5:156395535-156395557 GGGAAGGTTGCTGCATTTTGTGG + Intronic
1000838883 5:166191025-166191047 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1002297581 5:178240057-178240079 GCTCAGGTTGCTGGGGGTTGGGG + Intronic
1002985231 6:2183764-2183786 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1003008253 6:2402061-2402083 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1003312899 6:4984933-4984955 GGGCTGGTTCCATCAGGTTGAGG + Intergenic
1003461620 6:6334067-6334089 GGGCAGGTTGCTGCAGGCTGTGG + Intergenic
1003662478 6:8075669-8075691 GTGGTGGTTGCTGGAGGTTGGGG + Intronic
1003675578 6:8201511-8201533 TGGCTAGTTGCTGCAGGTCGTGG + Intergenic
1004001130 6:11598403-11598425 GGCCAGGGTGCTGGAGGTAGGGG - Intergenic
1004039349 6:11960543-11960565 GGGCTGGTTGCTGCAGGTTGAGG - Intergenic
1004174671 6:13329022-13329044 GGGCAGGTTGCTGCAGGTTGTGG + Intergenic
1004188525 6:13443851-13443873 GTGCTGGTTGCTGAAGGTTGGGG - Intronic
1004232928 6:13849350-13849372 GGGCAGGCTGCTGCAGGCTGTGG + Intergenic
1004302386 6:14470232-14470254 GGGCAGATTCCTGCAGATTGTGG - Intergenic
1006214297 6:32426480-32426502 AGGCAGGCTGCTGTAGGCTGTGG - Intergenic
1006392389 6:33766155-33766177 GGGCATGGTGCTGCAGCTGGGGG - Intergenic
1006791239 6:36702666-36702688 GGGCAGCTTCCTGCAAGTGGTGG - Intronic
1006809979 6:36813757-36813779 GGGCAGGGTGTTGCAGGTGGAGG - Intronic
1007379911 6:41482386-41482408 GTGGCGGTTGCTGAAGGTTGGGG - Intergenic
1007688172 6:43679834-43679856 AGGCAGGTTGCAGTGGGTTGGGG + Intronic
1007905087 6:45451745-45451767 GTACAGGTTGCTGAAGGATGAGG + Intronic
1008196897 6:48535661-48535683 GAACCGGTTGCTGCAGATTGTGG - Intergenic
1009607302 6:65888446-65888468 GGGCTAATTGCTGCAGGTTGTGG + Intergenic
1010864449 6:80957133-80957155 GGACTGGTGGCTGCAGATTGTGG - Intergenic
1011314474 6:86016432-86016454 AGGCAGGCTGGTGCAGGATGTGG + Intergenic
1012234639 6:96799059-96799081 GGGAAGGTATCTGCAGGTCGGGG + Exonic
1013282760 6:108654139-108654161 GGGCAGGATGCTGCAGGGAGTGG + Intronic
1013347240 6:109272998-109273020 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1013615150 6:111835940-111835962 GGACAGGTTTCTGCAGGTGGTGG + Intronic
1014278555 6:119416294-119416316 GGCCAGGGTGCTGCAGGCAGTGG + Intergenic
1015208286 6:130666899-130666921 GGGCACATTGCTGCAGCTTTTGG - Intergenic
1015518007 6:134103283-134103305 GGGCACATTGCTGCAGGTTGTGG + Intergenic
1015648188 6:135419725-135419747 GGGGTGGTTGCTGAAGGCTGGGG + Intronic
1016343938 6:143090783-143090805 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1016573149 6:145537235-145537257 GGATAGGTTGCTACAAGTTGTGG + Intronic
1016674776 6:146751129-146751151 GGGCATGTTGCGGGAGGGTGGGG - Intronic
1016797955 6:148137947-148137969 GGGCTGGTTGCTGCAGACTGTGG + Intergenic
1016849336 6:148601157-148601179 GGGCTGGTTACTCCAAGTTGTGG - Intergenic
1017191200 6:151654583-151654605 GGGGTGGTGGCTGCAGCTTGGGG + Intergenic
1017349930 6:153427971-153427993 GGACTGGTTGCTGCAGATTATGG + Intergenic
1017557224 6:155584160-155584182 GGGCAGGTTGCTGCAGGGGTGGG + Intergenic
1017747681 6:157461426-157461448 GGGCAGATTGCTGTGGGTTTTGG + Intronic
1017799701 6:157883065-157883087 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1018419034 6:163626152-163626174 GGGCAGGATGCTGCAGGAAGTGG + Intergenic
1018818448 6:167353946-167353968 GTGGAGGTTGCTGAAGGTTGGGG - Intronic
1018929401 6:168230710-168230732 GGGCAGGCTGATGCAGGTGTGGG - Intergenic
1019283323 7:211325-211347 GGGGAGGTTTCGGGAGGTTGTGG - Intronic
1019435677 7:1021014-1021036 GGGCAGGTACCTCCAGGTTGGGG + Intronic
1019591080 7:1832963-1832985 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1019735553 7:2648314-2648336 GGGCAGGTTGCTTCAGGTCCTGG - Intronic
1019781733 7:2944415-2944437 GGCCAGGTTGCGGCAGCTGGAGG - Exonic
1020101014 7:5394474-5394496 GGGCAGGTTGCTAGGGGTTGGGG + Exonic
1021219100 7:17954090-17954112 TAGCAGGTTGCTGAAGGTTGGGG - Intergenic
1022801363 7:33780308-33780330 GGGCAGCTGGGTCCAGGTTGGGG - Intergenic
1022891509 7:34704926-34704948 GAGCTGGTTGCTGCAGGTTGTGG + Intronic
1023912907 7:44568078-44568100 GGGCAGGAGGCAGCAGGCTGGGG - Intronic
1024168906 7:46764239-46764261 GGGCAGTTTGCCACAGATTGTGG - Intergenic
1024589273 7:50867153-50867175 GGGCAGGTTGCTGGGGGATGTGG + Intergenic
1024852728 7:53740101-53740123 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1024961489 7:54981434-54981456 GGGCTGGCTGCTGCAGGGGGTGG - Intergenic
1024995310 7:55269709-55269731 GGGCTGGTGGCTGCAGGGGGTGG - Intergenic
1025073532 7:55922571-55922593 GAGGTGGTTGCTGAAGGTTGGGG - Intronic
1026540547 7:71276220-71276242 GGGCAGGTGGCTGCAGGGGTGGG + Intronic
1029050061 7:97676719-97676741 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1029287474 7:99475761-99475783 GAGCTGGTTGCTGCAGGGTGTGG + Intronic
1029401434 7:100349298-100349320 GGGCAGCTTCCTGAAGGTGGTGG + Intronic
1030111692 7:106032214-106032236 GGGCAGGCTGGTGGAGATTGTGG + Intronic
1030161401 7:106512146-106512168 GGGCAGGTGGCTGGAGGTGTGGG - Intergenic
1031690199 7:124778395-124778417 GGGCATGTTTCTGCATGTGGGGG + Intronic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1031918256 7:127583003-127583025 GAAGAGGCTGCTGCAGGTTGCGG - Exonic
1032235351 7:130117279-130117301 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1033080396 7:138291119-138291141 GTGGTGGTTGCTGAAGGTTGTGG + Intergenic
1033401204 7:141026947-141026969 GGCCAGGATGTTGCAGGTGGTGG + Intergenic
1033468867 7:141624970-141624992 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1034255006 7:149720094-149720116 GGGCAGGAGCCTGCTGGTTGTGG + Exonic
1034981416 7:155480279-155480301 GATCAGGGTGCTGAAGGTTGGGG - Intronic
1035036199 7:155896534-155896556 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1035092240 7:156322971-156322993 GTGGGGGTTGCTGAAGGTTGGGG + Intergenic
1035283343 7:157791534-157791556 GGGCAGGTGGGTGCAGGGAGCGG - Intronic
1035283362 7:157791576-157791598 GGGCAGGTGGGTGCAGGGAGGGG - Intronic
1036144382 8:6240925-6240947 GGGCAAATTGCTGCAGGCTTTGG - Intergenic
1036610631 8:10346881-10346903 GGGCTGGTTGCTGCAGGTTGTGG + Intronic
1037901467 8:22691798-22691820 GGGCAGGTAGCTGCAGCTACAGG + Intronic
1038021855 8:23557692-23557714 GGCCAGGGGGCTGCAGGGTGAGG + Intronic
1038392824 8:27220577-27220599 ACGCTGGTTGCTGAAGGTTGGGG + Intergenic
1038501127 8:28044758-28044780 GGGCAGGTGGCTGCAGGTTGTGG + Intronic
1039382239 8:37096974-37096996 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1040285099 8:46095448-46095470 GGGGAGGTTGAGGCAGGTAGAGG + Intergenic
1040636384 8:49278865-49278887 GGTTTGGTTGCTGAAGGTTGTGG - Intergenic
1040960993 8:53032594-53032616 CTGGAGGTTGCTGCAGATTGTGG + Intergenic
1041131170 8:54702598-54702620 GTGGTGGTTGCTGCAGATTGGGG + Intergenic
1041149751 8:54919278-54919300 GGGAAGGTTCCTGCAGGGTCAGG - Intergenic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1041779902 8:61566674-61566696 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1044640082 8:94370442-94370464 GTGAAGGTTGCTGAGGGTTGGGG - Intergenic
1045038525 8:98197430-98197452 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1045355271 8:101382330-101382352 GTGGTGGTTGCTGAAGGTTGAGG + Intergenic
1045381254 8:101629199-101629221 GTGAGGGTTGCTGAAGGTTGGGG - Intronic
1045533781 8:103008215-103008237 GGGAAGGTAGCTGCAGCGTGTGG + Intergenic
1045967178 8:108038643-108038665 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1046168509 8:110472363-110472385 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1047178032 8:122559898-122559920 GTGCTGGTTGCTGAAGGCTGGGG + Intergenic
1047279748 8:123434785-123434807 GAGAAGGTTGCTGCAGATGGAGG + Intronic
1047301758 8:123619431-123619453 GGACAGGCTGCTGCAGGTTTTGG + Intergenic
1049278838 8:141733793-141733815 AGGCAGCTTGCTGCAGAGTGAGG - Intergenic
1049353653 8:142177334-142177356 GAACAGGCTGCTGCAGGTAGGGG + Intergenic
1049469161 8:142767710-142767732 GGGCAGGATGCTGCAGTTCACGG - Intronic
1049783294 8:144438792-144438814 GGGGAGCTTGCAGCAGGGTGGGG - Intronic
1049818693 8:144621108-144621130 GGGCAGGCAGCTGCAGGCTGGGG - Intergenic
1050498677 9:6271194-6271216 TGGAAGCCTGCTGCAGGTTGAGG + Intergenic
1050537201 9:6641204-6641226 GGGGAGGCTGCTGGAGGTAGTGG - Intronic
1051254316 9:15196910-15196932 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1051777631 9:20653541-20653563 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1052186768 9:25606557-25606579 GTGATGGTTGCTGAAGGTTGGGG - Intergenic
1052626019 9:30978460-30978482 AGGCAGATTGCTGCAGGTATGGG + Intergenic
1053172383 9:35898120-35898142 GTGGTGGTTGCTGAAGGTTGAGG + Intergenic
1054839540 9:69721666-69721688 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1054847561 9:69812563-69812585 GGGCCGGTTGTTACAGGCTGTGG + Intergenic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055778157 9:79788950-79788972 GGGCAGGTTGCTTCAGGTTGTGG + Intergenic
1056227388 9:84509451-84509473 GTGCTGGTTGCTGAAGGTTGGGG - Intergenic
1056602021 9:88053927-88053949 GGGCAGCTTGCTGCAGACTGTGG - Intergenic
1057037095 9:91818902-91818924 GGGCAGGACTCTGCAGGCTGGGG - Intronic
1057250327 9:93495730-93495752 GTGGTGGTTGCTGGAGGTTGGGG + Intronic
1057284749 9:93742984-93743006 GCGGAGGTTCCTGGAGGTTGGGG - Intergenic
1057386044 9:94606778-94606800 GGGGAGGGTGGTGCAGGTTCTGG - Intronic
1057561768 9:96133447-96133469 GGTCTGGTTGCTGCAGATGGTGG - Intergenic
1057778999 9:98034765-98034787 GGGAAGGTCCCCGCAGGTTGCGG + Intergenic
1059392057 9:114005557-114005579 GGGCAGGTGGCGGCAGATGGCGG + Intronic
1059681633 9:116591322-116591344 GGGCAGGTGGCTTCAGGTTCCGG - Intronic
1060565439 9:124587060-124587082 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1061309804 9:129754810-129754832 GGGCAGGATGCAGCAAGGTGAGG - Intergenic
1061590886 9:131596820-131596842 GGGCCGCTTGCTGCAGTTTTGGG - Intronic
1061596799 9:131635738-131635760 GGGGAGGGGGCAGCAGGTTGGGG + Intronic
1061752675 9:132791743-132791765 GGGCAGGTTGCTGCAGGTTGTGG - Intronic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1062059910 9:134489702-134489724 GGGTGGGTTGCTGCGGATTGTGG + Intergenic
1062591623 9:137277170-137277192 GGGCAGGGGGCTCCAGGCTGGGG + Intergenic
1187026790 X:15444206-15444228 GTGGTGGTTGCTGAAGGTTGGGG - Intronic
1187448600 X:19378054-19378076 GTGCAGGTTTCTGCCGGTTGAGG - Intronic
1187516834 X:19979287-19979309 GGGTTGGTTGTTGAAGGTTGGGG - Intergenic
1187680856 X:21766771-21766793 AAGCAGGTCACTGCAGGTTGTGG + Intergenic
1188221938 X:27551270-27551292 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1188835430 X:34948553-34948575 GTGCATGTCCCTGCAGGTTGTGG - Intergenic
1189014664 X:37084864-37084886 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1189829985 X:44962886-44962908 GTGGTGGTTGCTGCAGGTTGGGG + Intronic
1190482043 X:50887147-50887169 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1192480688 X:71482693-71482715 GTGGTGGTTGCTGAAGGTTGGGG + Intronic
1192988178 X:76422944-76422966 AGGCAAGTTGTTGAAGGTTGCGG + Intergenic
1193520674 X:82525370-82525392 GTGGTGGTTGCTGGAGGTTGAGG - Intergenic
1193686023 X:84578203-84578225 GTGGTGGTTGCTGAAGGTTGAGG - Intergenic
1194001700 X:88437737-88437759 GGACTGGTTGCTGCAGATAGTGG - Intergenic
1194874731 X:99173078-99173100 GTGGTGGTTGCTGAAGGTTGAGG + Intergenic
1194940381 X:100002173-100002195 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1195332001 X:103810218-103810240 GGGGAGATTGGTGCAGGTGGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197444040 X:126526356-126526378 GTGGTGGTTGCTGAAGGTTGGGG + Intergenic
1197893710 X:131289259-131289281 GGGCAGTTTGCTGCATCTGGAGG - Exonic
1198727219 X:139690961-139690983 AGGGAGGATGCTGCAGGCTGTGG - Intronic
1199103138 X:143829682-143829704 GTGATGGTTGCTGAAGGTTGGGG - Intergenic
1199139286 X:144290448-144290470 GGGCACGCTGCTGCAAGTGGTGG - Intergenic
1199289842 X:146093495-146093517 GGGCACGTTGCTGCAAGTGGTGG + Intergenic
1201143971 Y:11052364-11052386 GTGGTGGTTGCTGAAGGTTGGGG - Intergenic
1201266010 Y:12207360-12207382 GGGCAGGATGGTGGGGGTTGAGG - Intergenic
1202115341 Y:21466053-21466075 GGGCAGGTGGTTGCAGCTTAGGG + Intergenic