ID: 904352869

View in Genome Browser
Species Human (GRCh38)
Location 1:29920345-29920367
Sequence TGGGGCTGAAAAGTGCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904352869_904352873 23 Left 904352869 1:29920345-29920367 CCAACTGGCACTTTTCAGCCCCA No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904352869 Original CRISPR TGGGGCTGAAAAGTGCCAGT TGG (reversed) Intergenic