ID: 904352873

View in Genome Browser
Species Human (GRCh38)
Location 1:29920391-29920413
Sequence GTCGTTTAAGCCCCAGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904352870_904352873 5 Left 904352870 1:29920363-29920385 CCCCAAGAACTGTGAGAAGTGCA No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data
904352869_904352873 23 Left 904352869 1:29920345-29920367 CCAACTGGCACTTTTCAGCCCCA No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data
904352868_904352873 24 Left 904352868 1:29920344-29920366 CCCAACTGGCACTTTTCAGCCCC No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data
904352871_904352873 4 Left 904352871 1:29920364-29920386 CCCAAGAACTGTGAGAAGTGCAT No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data
904352872_904352873 3 Left 904352872 1:29920365-29920387 CCAAGAACTGTGAGAAGTGCATG No data
Right 904352873 1:29920391-29920413 GTCGTTTAAGCCCCAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904352873 Original CRISPR GTCGTTTAAGCCCCAGTCTA TGG Intergenic