ID: 904354721

View in Genome Browser
Species Human (GRCh38)
Location 1:29931494-29931516
Sequence CTCTCTGTGCAGAGACACTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354721_904354726 10 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354726 1:29931527-29931549 TCCCACCTCCTCCGACAATCTGG No data
904354721_904354731 18 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354731 1:29931535-29931557 CCTCCGACAATCTGGCATTCAGG No data
904354721_904354733 24 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354733 1:29931541-29931563 ACAATCTGGCATTCAGGCTGTGG No data
904354721_904354734 25 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354734 1:29931542-29931564 CAATCTGGCATTCAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904354721 Original CRISPR CTCTCTGTGCAGAGACACTT CGG (reversed) Intergenic
No off target data available for this crispr