ID: 904354726

View in Genome Browser
Species Human (GRCh38)
Location 1:29931527-29931549
Sequence TCCCACCTCCTCCGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354720_904354726 11 Left 904354720 1:29931493-29931515 CCCGAAGTGTCTCTGCACAGAGA No data
Right 904354726 1:29931527-29931549 TCCCACCTCCTCCGACAATCTGG No data
904354718_904354726 28 Left 904354718 1:29931476-29931498 CCTGTCTCCTTTGTCTTCCCGAA No data
Right 904354726 1:29931527-29931549 TCCCACCTCCTCCGACAATCTGG No data
904354721_904354726 10 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354726 1:29931527-29931549 TCCCACCTCCTCCGACAATCTGG No data
904354719_904354726 21 Left 904354719 1:29931483-29931505 CCTTTGTCTTCCCGAAGTGTCTC No data
Right 904354726 1:29931527-29931549 TCCCACCTCCTCCGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904354726 Original CRISPR TCCCACCTCCTCCGACAATC TGG Intergenic
No off target data available for this crispr