ID: 904354731

View in Genome Browser
Species Human (GRCh38)
Location 1:29931535-29931557
Sequence CCTCCGACAATCTGGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354720_904354731 19 Left 904354720 1:29931493-29931515 CCCGAAGTGTCTCTGCACAGAGA No data
Right 904354731 1:29931535-29931557 CCTCCGACAATCTGGCATTCAGG No data
904354719_904354731 29 Left 904354719 1:29931483-29931505 CCTTTGTCTTCCCGAAGTGTCTC No data
Right 904354731 1:29931535-29931557 CCTCCGACAATCTGGCATTCAGG No data
904354721_904354731 18 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354731 1:29931535-29931557 CCTCCGACAATCTGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904354731 Original CRISPR CCTCCGACAATCTGGCATTC AGG Intergenic
No off target data available for this crispr