ID: 904354733

View in Genome Browser
Species Human (GRCh38)
Location 1:29931541-29931563
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354721_904354733 24 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354733 1:29931541-29931563 ACAATCTGGCATTCAGGCTGTGG No data
904354727_904354733 -10 Left 904354727 1:29931528-29931550 CCCACCTCCTCCGACAATCTGGC No data
Right 904354733 1:29931541-29931563 ACAATCTGGCATTCAGGCTGTGG No data
904354720_904354733 25 Left 904354720 1:29931493-29931515 CCCGAAGTGTCTCTGCACAGAGA No data
Right 904354733 1:29931541-29931563 ACAATCTGGCATTCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr