ID: 904354734

View in Genome Browser
Species Human (GRCh38)
Location 1:29931542-29931564
Sequence CAATCTGGCATTCAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354728_904354734 -10 Left 904354728 1:29931529-29931551 CCACCTCCTCCGACAATCTGGCA No data
Right 904354734 1:29931542-29931564 CAATCTGGCATTCAGGCTGTGGG No data
904354727_904354734 -9 Left 904354727 1:29931528-29931550 CCCACCTCCTCCGACAATCTGGC No data
Right 904354734 1:29931542-29931564 CAATCTGGCATTCAGGCTGTGGG No data
904354721_904354734 25 Left 904354721 1:29931494-29931516 CCGAAGTGTCTCTGCACAGAGAG No data
Right 904354734 1:29931542-29931564 CAATCTGGCATTCAGGCTGTGGG No data
904354720_904354734 26 Left 904354720 1:29931493-29931515 CCCGAAGTGTCTCTGCACAGAGA No data
Right 904354734 1:29931542-29931564 CAATCTGGCATTCAGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904354734 Original CRISPR CAATCTGGCATTCAGGCTGT GGG Intergenic
No off target data available for this crispr