ID: 904354909

View in Genome Browser
Species Human (GRCh38)
Location 1:29932752-29932774
Sequence AGTGTGGATGGGTCAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904354900_904354909 20 Left 904354900 1:29932709-29932731 CCTAGCCCAGAAGCAGCGGCTGC No data
Right 904354909 1:29932752-29932774 AGTGTGGATGGGTCAGCAGAAGG No data
904354902_904354909 14 Left 904354902 1:29932715-29932737 CCAGAAGCAGCGGCTGCTAGCGT No data
Right 904354909 1:29932752-29932774 AGTGTGGATGGGTCAGCAGAAGG No data
904354901_904354909 15 Left 904354901 1:29932714-29932736 CCCAGAAGCAGCGGCTGCTAGCG No data
Right 904354909 1:29932752-29932774 AGTGTGGATGGGTCAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904354909 Original CRISPR AGTGTGGATGGGTCAGCAGA AGG Intergenic