ID: 904356798

View in Genome Browser
Species Human (GRCh38)
Location 1:29945482-29945504
Sequence ACCTATTACGTGCCAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904356798_904356800 -6 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356798_904356801 5 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data
904356798_904356802 13 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356802 1:29945518-29945540 ATGGCTACACGAAGGAATGAAGG No data
904356798_904356803 25 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356803 1:29945530-29945552 AGGAATGAAGGAAGAGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904356798 Original CRISPR ACCTATTACGTGCCAGGTTC TGG (reversed) Intergenic