ID: 904356800

View in Genome Browser
Species Human (GRCh38)
Location 1:29945499-29945521
Sequence ATAGGTGTCAATATGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904356791_904356800 20 Left 904356791 1:29945456-29945478 CCTGTTCCCTGCTGTATCTCTGG No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356798_904356800 -6 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356794_904356800 13 Left 904356794 1:29945463-29945485 CCTGCTGTATCTCTGGCACCCAG No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356793_904356800 14 Left 904356793 1:29945462-29945484 CCCTGCTGTATCTCTGGCACCCA No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356790_904356800 25 Left 904356790 1:29945451-29945473 CCGTGCCTGTTCCCTGCTGTATC No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data
904356796_904356800 -5 Left 904356796 1:29945481-29945503 CCCAGAACCTGGCACGTAATAGG No data
Right 904356800 1:29945499-29945521 ATAGGTGTCAATATGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904356800 Original CRISPR ATAGGTGTCAATATGAGTGA TGG Intergenic
No off target data available for this crispr