ID: 904356801

View in Genome Browser
Species Human (GRCh38)
Location 1:29945510-29945532
Sequence TATGAGTGATGGCTACACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904356796_904356801 6 Left 904356796 1:29945481-29945503 CCCAGAACCTGGCACGTAATAGG No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data
904356798_904356801 5 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data
904356799_904356801 -1 Left 904356799 1:29945488-29945510 CCTGGCACGTAATAGGTGTCAAT No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data
904356794_904356801 24 Left 904356794 1:29945463-29945485 CCTGCTGTATCTCTGGCACCCAG No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data
904356793_904356801 25 Left 904356793 1:29945462-29945484 CCCTGCTGTATCTCTGGCACCCA No data
Right 904356801 1:29945510-29945532 TATGAGTGATGGCTACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904356801 Original CRISPR TATGAGTGATGGCTACACGA AGG Intergenic
No off target data available for this crispr