ID: 904356803

View in Genome Browser
Species Human (GRCh38)
Location 1:29945530-29945552
Sequence AGGAATGAAGGAAGAGACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904356796_904356803 26 Left 904356796 1:29945481-29945503 CCCAGAACCTGGCACGTAATAGG No data
Right 904356803 1:29945530-29945552 AGGAATGAAGGAAGAGACTGCGG No data
904356799_904356803 19 Left 904356799 1:29945488-29945510 CCTGGCACGTAATAGGTGTCAAT No data
Right 904356803 1:29945530-29945552 AGGAATGAAGGAAGAGACTGCGG No data
904356798_904356803 25 Left 904356798 1:29945482-29945504 CCAGAACCTGGCACGTAATAGGT No data
Right 904356803 1:29945530-29945552 AGGAATGAAGGAAGAGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904356803 Original CRISPR AGGAATGAAGGAAGAGACTG CGG Intergenic
No off target data available for this crispr