ID: 904357919

View in Genome Browser
Species Human (GRCh38)
Location 1:29953308-29953330
Sequence CATGGTAATCTTGGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904357919_904357927 10 Left 904357919 1:29953308-29953330 CCTTCCTGGCCAAGATTACCATG No data
Right 904357927 1:29953341-29953363 CACATCTCAGGTAGGGGTAGAGG No data
904357919_904357924 2 Left 904357919 1:29953308-29953330 CCTTCCTGGCCAAGATTACCATG No data
Right 904357924 1:29953333-29953355 CACAATATCACATCTCAGGTAGG No data
904357919_904357923 -2 Left 904357919 1:29953308-29953330 CCTTCCTGGCCAAGATTACCATG No data
Right 904357923 1:29953329-29953351 TGAACACAATATCACATCTCAGG No data
904357919_904357926 4 Left 904357919 1:29953308-29953330 CCTTCCTGGCCAAGATTACCATG No data
Right 904357926 1:29953335-29953357 CAATATCACATCTCAGGTAGGGG No data
904357919_904357925 3 Left 904357919 1:29953308-29953330 CCTTCCTGGCCAAGATTACCATG No data
Right 904357925 1:29953334-29953356 ACAATATCACATCTCAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904357919 Original CRISPR CATGGTAATCTTGGCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr