ID: 904357933

View in Genome Browser
Species Human (GRCh38)
Location 1:29953447-29953469
Sequence CTGCAGAAATAGAAAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904357929_904357933 1 Left 904357929 1:29953423-29953445 CCATTTGATCTGCAAGTCTGGCC No data
Right 904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904357933 Original CRISPR CTGCAGAAATAGAAAGAGCC TGG Intergenic
No off target data available for this crispr