ID: 904360161

View in Genome Browser
Species Human (GRCh38)
Location 1:29965947-29965969
Sequence CTGCCAAGGAGGGCTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904360147_904360161 28 Left 904360147 1:29965896-29965918 CCTCTAATCCTCCTGATAGCTGT No data
Right 904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG No data
904360151_904360161 17 Left 904360151 1:29965907-29965929 CCTGATAGCTGTCTGAGCAGGGT No data
Right 904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG No data
904360148_904360161 20 Left 904360148 1:29965904-29965926 CCTCCTGATAGCTGTCTGAGCAG No data
Right 904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904360161 Original CRISPR CTGCCAAGGAGGGCTCAGAG AGG Intergenic
No off target data available for this crispr