ID: 904362243

View in Genome Browser
Species Human (GRCh38)
Location 1:29983788-29983810
Sequence CCTTGCCATAAGGCAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904362243_904362250 18 Left 904362243 1:29983788-29983810 CCATGTCCTGCCTTATGGCAAGG No data
Right 904362250 1:29983829-29983851 GGAGTTACCCTCCCCAGTGCTGG No data
904362243_904362247 -8 Left 904362243 1:29983788-29983810 CCATGTCCTGCCTTATGGCAAGG No data
Right 904362247 1:29983803-29983825 TGGCAAGGCCTGCTGCTTAGTGG No data
904362243_904362248 -3 Left 904362243 1:29983788-29983810 CCATGTCCTGCCTTATGGCAAGG No data
Right 904362248 1:29983808-29983830 AGGCCTGCTGCTTAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904362243 Original CRISPR CCTTGCCATAAGGCAGGACA TGG (reversed) Intergenic
No off target data available for this crispr