ID: 904362962

View in Genome Browser
Species Human (GRCh38)
Location 1:29990417-29990439
Sequence TTGGGTTATCACTTCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904362955_904362962 17 Left 904362955 1:29990377-29990399 CCCTCAGGCAGCCTAGCAGAGGC No data
Right 904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG No data
904362957_904362962 6 Left 904362957 1:29990388-29990410 CCTAGCAGAGGCTGAGCGCCTGA No data
Right 904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG No data
904362953_904362962 18 Left 904362953 1:29990376-29990398 CCCCTCAGGCAGCCTAGCAGAGG No data
Right 904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG No data
904362956_904362962 16 Left 904362956 1:29990378-29990400 CCTCAGGCAGCCTAGCAGAGGCT No data
Right 904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904362962 Original CRISPR TTGGGTTATCACTTCTTGCA GGG Intergenic
No off target data available for this crispr