ID: 904362990

View in Genome Browser
Species Human (GRCh38)
Location 1:29990568-29990590
Sequence CAGATTAAGGAGGTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904362990_904362999 22 Left 904362990 1:29990568-29990590 CCTGTCTCCACCTCCTTAATCTG No data
Right 904362999 1:29990613-29990635 CGGTGCTTGGACAGAGTAGCCGG No data
904362990_904362996 9 Left 904362990 1:29990568-29990590 CCTGTCTCCACCTCCTTAATCTG No data
Right 904362996 1:29990600-29990622 CTGTCTTTGCCCACGGTGCTTGG No data
904362990_904362995 2 Left 904362990 1:29990568-29990590 CCTGTCTCCACCTCCTTAATCTG No data
Right 904362995 1:29990593-29990615 TGTATATCTGTCTTTGCCCACGG No data
904362990_904363001 24 Left 904362990 1:29990568-29990590 CCTGTCTCCACCTCCTTAATCTG No data
Right 904363001 1:29990615-29990637 GTGCTTGGACAGAGTAGCCGGGG No data
904362990_904363000 23 Left 904362990 1:29990568-29990590 CCTGTCTCCACCTCCTTAATCTG No data
Right 904363000 1:29990614-29990636 GGTGCTTGGACAGAGTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904362990 Original CRISPR CAGATTAAGGAGGTGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr