ID: 904368063

View in Genome Browser
Species Human (GRCh38)
Location 1:30029746-30029768
Sequence TAGGGACTGGAGGTCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904368050_904368063 21 Left 904368050 1:30029702-30029724 CCAAAAATCCTTAGCTTAAAGTG No data
Right 904368063 1:30029746-30029768 TAGGGACTGGAGGTCATCCCTGG No data
904368051_904368063 13 Left 904368051 1:30029710-30029732 CCTTAGCTTAAAGTGCTGAGACC No data
Right 904368063 1:30029746-30029768 TAGGGACTGGAGGTCATCCCTGG No data
904368055_904368063 -8 Left 904368055 1:30029731-30029753 CCCAGAAAGGCCCCCTAGGGACT No data
Right 904368063 1:30029746-30029768 TAGGGACTGGAGGTCATCCCTGG No data
904368056_904368063 -9 Left 904368056 1:30029732-30029754 CCAGAAAGGCCCCCTAGGGACTG No data
Right 904368063 1:30029746-30029768 TAGGGACTGGAGGTCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904368063 Original CRISPR TAGGGACTGGAGGTCATCCC TGG Intergenic
No off target data available for this crispr