ID: 904370719

View in Genome Browser
Species Human (GRCh38)
Location 1:30045948-30045970
Sequence CTGGGCTCAGGGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904370719_904370733 14 Left 904370719 1:30045948-30045970 CCAGCCTCCATCCCTGAGCCCAG No data
Right 904370733 1:30045985-30046007 CTGTTCCCAGACACTGGGTCAGG No data
904370719_904370731 9 Left 904370719 1:30045948-30045970 CCAGCCTCCATCCCTGAGCCCAG No data
Right 904370731 1:30045980-30046002 CCCAGCTGTTCCCAGACACTGGG No data
904370719_904370734 15 Left 904370719 1:30045948-30045970 CCAGCCTCCATCCCTGAGCCCAG No data
Right 904370734 1:30045986-30046008 TGTTCCCAGACACTGGGTCAGGG No data
904370719_904370729 8 Left 904370719 1:30045948-30045970 CCAGCCTCCATCCCTGAGCCCAG No data
Right 904370729 1:30045979-30046001 CCCCAGCTGTTCCCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904370719 Original CRISPR CTGGGCTCAGGGATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr