ID: 904371190

View in Genome Browser
Species Human (GRCh38)
Location 1:30048487-30048509
Sequence CAGATGGGCAGCCCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371190_904371199 -2 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371199 1:30048508-30048530 TGCACAGCAGTGTGGGCATCGGG No data
904371190_904371204 18 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371204 1:30048528-30048550 GGGCAGAGGCTTGGCAGGGCCGG No data
904371190_904371200 4 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371190_904371195 -9 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371195 1:30048501-30048523 GCCCATCTGCACAGCAGTGTGGG No data
904371190_904371194 -10 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371194 1:30048500-30048522 TGCCCATCTGCACAGCAGTGTGG No data
904371190_904371201 9 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371201 1:30048519-30048541 GTGGGCATCGGGCAGAGGCTTGG No data
904371190_904371198 -3 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371198 1:30048507-30048529 CTGCACAGCAGTGTGGGCATCGG No data
904371190_904371202 13 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371190_904371203 14 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371190 Original CRISPR CAGATGGGCAGCCCTGGGCA GGG (reversed) Intergenic