ID: 904371191

View in Genome Browser
Species Human (GRCh38)
Location 1:30048488-30048510
Sequence GCAGATGGGCAGCCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371191_904371201 8 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371201 1:30048519-30048541 GTGGGCATCGGGCAGAGGCTTGG No data
904371191_904371203 13 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371191_904371200 3 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371191_904371202 12 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371191_904371195 -10 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371195 1:30048501-30048523 GCCCATCTGCACAGCAGTGTGGG No data
904371191_904371204 17 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371204 1:30048528-30048550 GGGCAGAGGCTTGGCAGGGCCGG No data
904371191_904371198 -4 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371198 1:30048507-30048529 CTGCACAGCAGTGTGGGCATCGG No data
904371191_904371199 -3 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371199 1:30048508-30048530 TGCACAGCAGTGTGGGCATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371191 Original CRISPR GCAGATGGGCAGCCCTGGGC AGG (reversed) Intergenic
No off target data available for this crispr