ID: 904371192

View in Genome Browser
Species Human (GRCh38)
Location 1:30048492-30048514
Sequence CTGTGCAGATGGGCAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371192_904371204 13 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371204 1:30048528-30048550 GGGCAGAGGCTTGGCAGGGCCGG No data
904371192_904371202 8 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371192_904371201 4 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371201 1:30048519-30048541 GTGGGCATCGGGCAGAGGCTTGG No data
904371192_904371198 -8 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371198 1:30048507-30048529 CTGCACAGCAGTGTGGGCATCGG No data
904371192_904371203 9 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371192_904371199 -7 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371199 1:30048508-30048530 TGCACAGCAGTGTGGGCATCGGG No data
904371192_904371200 -1 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371192 Original CRISPR CTGTGCAGATGGGCAGCCCT GGG (reversed) Intergenic
No off target data available for this crispr