ID: 904371197

View in Genome Browser
Species Human (GRCh38)
Location 1:30048503-30048525
Sequence TGCCCACACTGCTGTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371197_904371203 -2 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371197_904371201 -7 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371201 1:30048519-30048541 GTGGGCATCGGGCAGAGGCTTGG No data
904371197_904371204 2 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371204 1:30048528-30048550 GGGCAGAGGCTTGGCAGGGCCGG No data
904371197_904371202 -3 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371197 Original CRISPR TGCCCACACTGCTGTGCAGA TGG (reversed) Intergenic
No off target data available for this crispr