ID: 904371200

View in Genome Browser
Species Human (GRCh38)
Location 1:30048514-30048536
Sequence GCAGTGTGGGCATCGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371189_904371200 9 Left 904371189 1:30048482-30048504 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371186_904371200 22 Left 904371186 1:30048469-30048491 CCTGTTGACAGTACCTCTCCCTG No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371192_904371200 -1 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371191_904371200 3 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371190_904371200 4 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371185_904371200 26 Left 904371185 1:30048465-30048487 CCTTCCTGTTGACAGTACCTCTC No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data
904371193_904371200 -2 Left 904371193 1:30048493-30048515 CCAGGGCTGCCCATCTGCACAGC No data
Right 904371200 1:30048514-30048536 GCAGTGTGGGCATCGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371200 Original CRISPR GCAGTGTGGGCATCGGGCAG AGG Intergenic