ID: 904371202

View in Genome Browser
Species Human (GRCh38)
Location 1:30048523-30048545
Sequence GCATCGGGCAGAGGCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371190_904371202 13 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371191_904371202 12 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371193_904371202 7 Left 904371193 1:30048493-30048515 CCAGGGCTGCCCATCTGCACAGC No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371189_904371202 18 Left 904371189 1:30048482-30048504 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371197_904371202 -3 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371192_904371202 8 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data
904371196_904371202 -2 Left 904371196 1:30048502-30048524 CCCATCTGCACAGCAGTGTGGGC No data
Right 904371202 1:30048523-30048545 GCATCGGGCAGAGGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371202 Original CRISPR GCATCGGGCAGAGGCTTGGC AGG Intergenic
No off target data available for this crispr