ID: 904371203

View in Genome Browser
Species Human (GRCh38)
Location 1:30048524-30048546
Sequence CATCGGGCAGAGGCTTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371193_904371203 8 Left 904371193 1:30048493-30048515 CCAGGGCTGCCCATCTGCACAGC No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371189_904371203 19 Left 904371189 1:30048482-30048504 CCTCTCCCTGCCCAGGGCTGCCC No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371190_904371203 14 Left 904371190 1:30048487-30048509 CCCTGCCCAGGGCTGCCCATCTG No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371191_904371203 13 Left 904371191 1:30048488-30048510 CCTGCCCAGGGCTGCCCATCTGC No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371192_904371203 9 Left 904371192 1:30048492-30048514 CCCAGGGCTGCCCATCTGCACAG No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371197_904371203 -2 Left 904371197 1:30048503-30048525 CCATCTGCACAGCAGTGTGGGCA No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data
904371196_904371203 -1 Left 904371196 1:30048502-30048524 CCCATCTGCACAGCAGTGTGGGC No data
Right 904371203 1:30048524-30048546 CATCGGGCAGAGGCTTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371203 Original CRISPR CATCGGGCAGAGGCTTGGCA GGG Intergenic