ID: 904371936

View in Genome Browser
Species Human (GRCh38)
Location 1:30053464-30053486
Sequence GTGGGGAGACCGCCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904371930_904371936 18 Left 904371930 1:30053423-30053445 CCTCCTGAAGTCTTCAGCTGAGT No data
Right 904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG No data
904371931_904371936 15 Left 904371931 1:30053426-30053448 CCTGAAGTCTTCAGCTGAGTAGC No data
Right 904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904371936 Original CRISPR GTGGGGAGACCGCCTGAGGA TGG Intergenic
No off target data available for this crispr