ID: 904372809

View in Genome Browser
Species Human (GRCh38)
Location 1:30060951-30060973
Sequence ACACCCTGGGTAGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904372809_904372816 -2 Left 904372809 1:30060951-30060973 CCAGCTGCAGCTACCCAGGGTGT No data
Right 904372816 1:30060972-30060994 GTGGGTGGCTCTGGCAGCAGTGG No data
904372809_904372818 10 Left 904372809 1:30060951-30060973 CCAGCTGCAGCTACCCAGGGTGT No data
Right 904372818 1:30060984-30061006 GGCAGCAGTGGGCCTAGTGATGG No data
904372809_904372820 24 Left 904372809 1:30060951-30060973 CCAGCTGCAGCTACCCAGGGTGT No data
Right 904372820 1:30060998-30061020 TAGTGATGGATTACATCAGCAGG No data
904372809_904372817 -1 Left 904372809 1:30060951-30060973 CCAGCTGCAGCTACCCAGGGTGT No data
Right 904372817 1:30060973-30060995 TGGGTGGCTCTGGCAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904372809 Original CRISPR ACACCCTGGGTAGCTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr