ID: 904372990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:30062374-30062396 |
| Sequence | AGTTATCTACAGAAGAGGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904372990_904372993 | 22 | Left | 904372990 | 1:30062374-30062396 | CCTATCCTCTTCTGTAGATAACT | No data | ||
| Right | 904372993 | 1:30062419-30062441 | CTTGGCTTTCTACTGAGCCCTGG | No data | ||||
| 904372990_904372992 | 4 | Left | 904372990 | 1:30062374-30062396 | CCTATCCTCTTCTGTAGATAACT | No data | ||
| Right | 904372992 | 1:30062401-30062423 | TGCATTTGAGAAATAGCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904372990 | Original CRISPR | AGTTATCTACAGAAGAGGAT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||