ID: 904372990

View in Genome Browser
Species Human (GRCh38)
Location 1:30062374-30062396
Sequence AGTTATCTACAGAAGAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904372990_904372993 22 Left 904372990 1:30062374-30062396 CCTATCCTCTTCTGTAGATAACT No data
Right 904372993 1:30062419-30062441 CTTGGCTTTCTACTGAGCCCTGG No data
904372990_904372992 4 Left 904372990 1:30062374-30062396 CCTATCCTCTTCTGTAGATAACT No data
Right 904372992 1:30062401-30062423 TGCATTTGAGAAATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904372990 Original CRISPR AGTTATCTACAGAAGAGGAT AGG (reversed) Intergenic
No off target data available for this crispr