ID: 904375181

View in Genome Browser
Species Human (GRCh38)
Location 1:30076594-30076616
Sequence CACAAGGATGGAGCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904375169_904375181 26 Left 904375169 1:30076545-30076567 CCACAGGCACTCAGCACCAACTG No data
Right 904375181 1:30076594-30076616 CACAAGGATGGAGCTGCCCAAGG No data
904375175_904375181 10 Left 904375175 1:30076561-30076583 CCAACTGCAGTGGGGGGCTGTAC No data
Right 904375181 1:30076594-30076616 CACAAGGATGGAGCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904375181 Original CRISPR CACAAGGATGGAGCTGCCCA AGG Intergenic
No off target data available for this crispr