ID: 904375903

View in Genome Browser
Species Human (GRCh38)
Location 1:30082386-30082408
Sequence CTTTGAAGGCAGCTCCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904375894_904375903 9 Left 904375894 1:30082354-30082376 CCTCCAGCATCCTCCACTGCTAC No data
Right 904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG No data
904375897_904375903 -4 Left 904375897 1:30082367-30082389 CCACTGCTACTCCCCTTCGCTTT No data
Right 904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG No data
904375896_904375903 -1 Left 904375896 1:30082364-30082386 CCTCCACTGCTACTCCCCTTCGC No data
Right 904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG No data
904375895_904375903 6 Left 904375895 1:30082357-30082379 CCAGCATCCTCCACTGCTACTCC No data
Right 904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904375903 Original CRISPR CTTTGAAGGCAGCTCCTGGA CGG Intergenic
No off target data available for this crispr