ID: 904377061

View in Genome Browser
Species Human (GRCh38)
Location 1:30088316-30088338
Sequence CCTGGCCTGCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904377061_904377072 22 Left 904377061 1:30088316-30088338 CCCTGCTCCTTCTGCAGGCCAGG No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904377061 Original CRISPR CCTGGCCTGCAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr