ID: 904377072

View in Genome Browser
Species Human (GRCh38)
Location 1:30088361-30088383
Sequence GCACATGCTGCCTCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904377064_904377072 15 Left 904377064 1:30088323-30088345 CCTTCTGCAGGCCAGGCCCATCC No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377061_904377072 22 Left 904377061 1:30088316-30088338 CCCTGCTCCTTCTGCAGGCCAGG No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377068_904377072 -6 Left 904377068 1:30088344-30088366 CCATGCCCTGCCTCTTTGCACAT No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377066_904377072 -1 Left 904377066 1:30088339-30088361 CCCATCCATGCCCTGCCTCTTTG No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377067_904377072 -2 Left 904377067 1:30088340-30088362 CCATCCATGCCCTGCCTCTTTGC No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377065_904377072 4 Left 904377065 1:30088334-30088356 CCAGGCCCATCCATGCCCTGCCT No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data
904377063_904377072 21 Left 904377063 1:30088317-30088339 CCTGCTCCTTCTGCAGGCCAGGC No data
Right 904377072 1:30088361-30088383 GCACATGCTGCCTCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904377072 Original CRISPR GCACATGCTGCCTCCCTGCC AGG Intergenic
No off target data available for this crispr