ID: 904377316

View in Genome Browser
Species Human (GRCh38)
Location 1:30090068-30090090
Sequence CTGACCTCCTGGAAGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904377316_904377329 13 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377329 1:30090104-30090126 GTCCAGTGAGGAGATGGAGGGGG No data
904377316_904377323 -9 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377323 1:30090082-30090104 GGAGGTCAGAATGGGAGCAGGGG No data
904377316_904377325 7 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377325 1:30090098-30090120 GCAGGGGTCCAGTGAGGAGATGG No data
904377316_904377332 25 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377332 1:30090116-30090138 GATGGAGGGGGACGTCCAGGCGG No data
904377316_904377331 22 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377331 1:30090113-30090135 GGAGATGGAGGGGGACGTCCAGG No data
904377316_904377328 12 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377328 1:30090103-30090125 GGTCCAGTGAGGAGATGGAGGGG No data
904377316_904377327 11 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377327 1:30090102-30090124 GGGTCCAGTGAGGAGATGGAGGG No data
904377316_904377322 -10 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377322 1:30090081-30090103 AGGAGGTCAGAATGGGAGCAGGG No data
904377316_904377326 10 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377326 1:30090101-30090123 GGGGTCCAGTGAGGAGATGGAGG No data
904377316_904377324 1 Left 904377316 1:30090068-30090090 CCCTAGCTCTTCCAGGAGGTCAG No data
Right 904377324 1:30090092-30090114 ATGGGAGCAGGGGTCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904377316 Original CRISPR CTGACCTCCTGGAAGAGCTA GGG (reversed) Intergenic
No off target data available for this crispr