ID: 904378047

View in Genome Browser
Species Human (GRCh38)
Location 1:30094123-30094145
Sequence CTGGCCTCAACCGCCTCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904378047_904378057 18 Left 904378047 1:30094123-30094145 CCATGCGAGGCGGTTGAGGCCAG No data
Right 904378057 1:30094164-30094186 ATCTCAAATCCCATCTGGCCTGG No data
904378047_904378058 19 Left 904378047 1:30094123-30094145 CCATGCGAGGCGGTTGAGGCCAG No data
Right 904378058 1:30094165-30094187 TCTCAAATCCCATCTGGCCTGGG No data
904378047_904378056 13 Left 904378047 1:30094123-30094145 CCATGCGAGGCGGTTGAGGCCAG No data
Right 904378056 1:30094159-30094181 GGCAGATCTCAAATCCCATCTGG No data
904378047_904378050 -8 Left 904378047 1:30094123-30094145 CCATGCGAGGCGGTTGAGGCCAG No data
Right 904378050 1:30094138-30094160 GAGGCCAGGAAGGCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904378047 Original CRISPR CTGGCCTCAACCGCCTCGCA TGG (reversed) Intergenic