ID: 904379978

View in Genome Browser
Species Human (GRCh38)
Location 1:30104018-30104040
Sequence GAGGCTTCCTGGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904379972_904379978 -8 Left 904379972 1:30104003-30104025 CCCGAGCAGAGGAGTGAGGCTTC No data
Right 904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG No data
904379973_904379978 -9 Left 904379973 1:30104004-30104026 CCGAGCAGAGGAGTGAGGCTTCC No data
Right 904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904379978 Original CRISPR GAGGCTTCCTGGAAGGAGGA GGG Intergenic
No off target data available for this crispr