ID: 904379978 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:30104018-30104040 |
Sequence | GAGGCTTCCTGGAAGGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904379972_904379978 | -8 | Left | 904379972 | 1:30104003-30104025 | CCCGAGCAGAGGAGTGAGGCTTC | No data | ||
Right | 904379978 | 1:30104018-30104040 | GAGGCTTCCTGGAAGGAGGAGGG | No data | ||||
904379973_904379978 | -9 | Left | 904379973 | 1:30104004-30104026 | CCGAGCAGAGGAGTGAGGCTTCC | No data | ||
Right | 904379978 | 1:30104018-30104040 | GAGGCTTCCTGGAAGGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904379978 | Original CRISPR | GAGGCTTCCTGGAAGGAGGA GGG | Intergenic | ||
No off target data available for this crispr |