ID: 904380595

View in Genome Browser
Species Human (GRCh38)
Location 1:30107998-30108020
Sequence CACACTCACATGGTGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904380595_904380599 23 Left 904380595 1:30107998-30108020 CCACAATACACCATGTGAGTGTG No data
Right 904380599 1:30108044-30108066 CAATTCTTTCTGCATTTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904380595 Original CRISPR CACACTCACATGGTGTATTG TGG (reversed) Intergenic
No off target data available for this crispr