ID: 904382579

View in Genome Browser
Species Human (GRCh38)
Location 1:30121343-30121365
Sequence ATCTGAAGGTAGGAGCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904382576_904382579 6 Left 904382576 1:30121314-30121336 CCAAGATGGAGACAGTGTTGGAC No data
Right 904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG No data
904382573_904382579 21 Left 904382573 1:30121299-30121321 CCACAGCACAGTGGACCAAGATG No data
Right 904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG No data
904382572_904382579 28 Left 904382572 1:30121292-30121314 CCTTAAGCCACAGCACAGTGGAC No data
Right 904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG No data
904382571_904382579 29 Left 904382571 1:30121291-30121313 CCCTTAAGCCACAGCACAGTGGA No data
Right 904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904382579 Original CRISPR ATCTGAAGGTAGGAGCATTG TGG Intergenic
No off target data available for this crispr