ID: 904382675

View in Genome Browser
Species Human (GRCh38)
Location 1:30121944-30121966
Sequence GCTCATTTGCAAAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904382675_904382679 -4 Left 904382675 1:30121944-30121966 CCTTCCCCACTTTGCAAATGAGC No data
Right 904382679 1:30121963-30121985 GAGCAAATACAACATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904382675 Original CRISPR GCTCATTTGCAAAGTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr