ID: 904382689

View in Genome Browser
Species Human (GRCh38)
Location 1:30122050-30122072
Sequence TGGGAGCCCCATCATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904382681_904382689 29 Left 904382681 1:30121998-30122020 CCAAAGAGCTACTAAGTAACAAT No data
Right 904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG No data
904382680_904382689 30 Left 904382680 1:30121997-30122019 CCCAAAGAGCTACTAAGTAACAA No data
Right 904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG No data
904382687_904382689 -4 Left 904382687 1:30122031-30122053 CCAGGCTGGTGATGACATGTGGG No data
Right 904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG No data
904382685_904382689 4 Left 904382685 1:30122023-30122045 CCTGGTGTCCAGGCTGGTGATGA No data
Right 904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904382689 Original CRISPR TGGGAGCCCCATCATGAGCA TGG Intergenic
No off target data available for this crispr