ID: 904382984

View in Genome Browser
Species Human (GRCh38)
Location 1:30124095-30124117
Sequence GTGGGGTCCTATCCTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904382980_904382984 -5 Left 904382980 1:30124077-30124099 CCTCAGGCCATCTTTAGGGTGGG No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382973_904382984 5 Left 904382973 1:30124067-30124089 CCCTCCCTGGCCTCAGGCCATCT No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382972_904382984 10 Left 904382972 1:30124062-30124084 CCACACCCTCCCTGGCCTCAGGC No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382970_904382984 13 Left 904382970 1:30124059-30124081 CCTCCACACCCTCCCTGGCCTCA No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382968_904382984 27 Left 904382968 1:30124045-30124067 CCTTTCTTGCTTCTCCTCCACAC No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382975_904382984 1 Left 904382975 1:30124071-30124093 CCCTGGCCTCAGGCCATCTTTAG No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382976_904382984 0 Left 904382976 1:30124072-30124094 CCTGGCCTCAGGCCATCTTTAGG No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data
904382974_904382984 4 Left 904382974 1:30124068-30124090 CCTCCCTGGCCTCAGGCCATCTT No data
Right 904382984 1:30124095-30124117 GTGGGGTCCTATCCTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904382984 Original CRISPR GTGGGGTCCTATCCTCTTCC TGG Intergenic