ID: 904383492

View in Genome Browser
Species Human (GRCh38)
Location 1:30126762-30126784
Sequence GAGGCACAGTACCATGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904383482_904383492 23 Left 904383482 1:30126716-30126738 CCTGTGGTGTGCATGCTGATTAG No data
Right 904383492 1:30126762-30126784 GAGGCACAGTACCATGTACAGGG No data
904383481_904383492 24 Left 904383481 1:30126715-30126737 CCCTGTGGTGTGCATGCTGATTA No data
Right 904383492 1:30126762-30126784 GAGGCACAGTACCATGTACAGGG No data
904383489_904383492 0 Left 904383489 1:30126739-30126761 CCTCTTCTGGGGATGGGGATACT No data
Right 904383492 1:30126762-30126784 GAGGCACAGTACCATGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904383492 Original CRISPR GAGGCACAGTACCATGTACA GGG Intergenic
No off target data available for this crispr