ID: 904384649

View in Genome Browser
Species Human (GRCh38)
Location 1:30133322-30133344
Sequence GCTGCCTGTACTGGCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904384649_904384653 -8 Left 904384649 1:30133322-30133344 CCAGCATGGCCAGTACAGGCAGC No data
Right 904384653 1:30133337-30133359 CAGGCAGCCATGGTAAAGAAGGG No data
904384649_904384655 5 Left 904384649 1:30133322-30133344 CCAGCATGGCCAGTACAGGCAGC No data
Right 904384655 1:30133350-30133372 TAAAGAAGGGTGTTCTGCTCTGG No data
904384649_904384652 -9 Left 904384649 1:30133322-30133344 CCAGCATGGCCAGTACAGGCAGC No data
Right 904384652 1:30133336-30133358 ACAGGCAGCCATGGTAAAGAAGG No data
904384649_904384657 30 Left 904384649 1:30133322-30133344 CCAGCATGGCCAGTACAGGCAGC No data
Right 904384657 1:30133375-30133397 CAGCAATCATTCAGGAACAGTGG No data
904384649_904384656 22 Left 904384649 1:30133322-30133344 CCAGCATGGCCAGTACAGGCAGC No data
Right 904384656 1:30133367-30133389 CTCTGGAGCAGCAATCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904384649 Original CRISPR GCTGCCTGTACTGGCCATGC TGG (reversed) Intergenic
No off target data available for this crispr