ID: 904389497

View in Genome Browser
Species Human (GRCh38)
Location 1:30172602-30172624
Sequence AGCATTCAAACTCAAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904389497_904389506 7 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389506 1:30172632-30172654 CCTTCTACCACTGGGGGATGGGG No data
904389497_904389507 12 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389507 1:30172637-30172659 TACCACTGGGGGATGGGGTAAGG No data
904389497_904389501 0 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389501 1:30172625-30172647 GGCAAATCCTTCTACCACTGGGG No data
904389497_904389502 1 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389502 1:30172626-30172648 GCAAATCCTTCTACCACTGGGGG No data
904389497_904389499 -2 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389499 1:30172623-30172645 CTGGCAAATCCTTCTACCACTGG No data
904389497_904389503 5 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389503 1:30172630-30172652 ATCCTTCTACCACTGGGGGATGG No data
904389497_904389504 6 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389504 1:30172631-30172653 TCCTTCTACCACTGGGGGATGGG No data
904389497_904389500 -1 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389500 1:30172624-30172646 TGGCAAATCCTTCTACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904389497 Original CRISPR AGCATTCAAACTCAAGCACC TGG (reversed) Intergenic
No off target data available for this crispr