ID: 904389502

View in Genome Browser
Species Human (GRCh38)
Location 1:30172626-30172648
Sequence GCAAATCCTTCTACCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904389496_904389502 2 Left 904389496 1:30172601-30172623 CCCAGGTGCTTGAGTTTGAATGC No data
Right 904389502 1:30172626-30172648 GCAAATCCTTCTACCACTGGGGG No data
904389497_904389502 1 Left 904389497 1:30172602-30172624 CCAGGTGCTTGAGTTTGAATGCT No data
Right 904389502 1:30172626-30172648 GCAAATCCTTCTACCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904389502 Original CRISPR GCAAATCCTTCTACCACTGG GGG Intergenic
No off target data available for this crispr