ID: 904390288

View in Genome Browser
Species Human (GRCh38)
Location 1:30180607-30180629
Sequence CAAACTACTTTTACTCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904390285_904390288 0 Left 904390285 1:30180584-30180606 CCAGCATCTTTCACAGAAAATCT No data
Right 904390288 1:30180607-30180629 CAAACTACTTTTACTCTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904390288 Original CRISPR CAAACTACTTTTACTCTAAG GGG Intergenic
No off target data available for this crispr